Dasypus_novemcinctus Locus Mono:390:SNORA73
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:390:SNORA73
Dasypus_novemcinctus
Mono:390:SNORA73
GeneScaffold_954
SNORA73
1001..1204
2204
CTAAAAGGATCAAATATTTAGGAATAAACTTTACCAAGGACATAAAGGACTTGTATTTA
GAAAACTACAAAACACTGCTAAAAGAAATCAGGAAAGACATAAATAAATGGGAGGGTATT
CTATGTTCATGGACTGGAAGACTAAACATTGTTAAGGTGTCAGTTCTACCCAAATTTATC
TACAGATTCAACACAATCTCAATAAAACTTCCAATAGCCTTTTTTACGGAATTGGAAAGG
CCATTTATCAGATTTATTTGGAAGGGTAATAGGTTCCAAATAGGCCAAAAATATCTTTTA
AAAAAGCAAAGTTGGAGAACTCTCCCTCCCTGACTTAAAGCANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCACAAAGGAATGCCCAATGTTAGAAAATC
TTAATATAGATGCTATTAAGGTTCTCTAGTCTGAATAAATGAACCCATGATCGCAAGGTT
TCACAATCCCAACACTCTCAAATAAGGCAGCTGGCTTCCTTGGGGAGAATCCTGACCTTG
CAGTGTCAAGAAAAGGGGATTCAAGTAAGGAGGTTAGAGGCAGACAGATTATTTCCCCTT
TGAATGAGAAGACAACTCAGCTTGAACAGAATATAAAATACACTAGATATTAATTAGGCA
GAAGTATGACTCAGCAAGGAAGGCAACGAAATTGGCAGACAGATACACCACAAGTTTCAT
TAAAAAAAAAAAAGATGACACATTTAAGTTTAGCAAATTTAATGCTATTTCCCTTTCACC
AAAATTCTATTGAATCTTCATGATCAAGAGTAGCTATTGGTCCAGTGTGGATACCCCGGG
AGGTCACTCTCCCCGGGCTCTGTCCAGGTGGCGCAGGGAGCACAGGGCTCTGCCCAGTGA
TGTACAGTCCCATTCCACGACATTGGAGAGGAAGCCGGGCTCTCGAGCTTGCACCTGCAT
ATTCCTACAGCTTCTCTGAGTCTTATTGACCACGACCAAGGAGACAAACCATACAGGAAA
CAGTTTTCTTGAGCATCACAGTCTGGATCCAGGGTCAGTTTACCACGTGTCCAAGAGAAG
TGCGCTTTGTCTTGTTTTTCATCTACTGGTGAATTACATTTATACTTTGTACCTTTGTTT
CACAGAATTCTCAAAAGAATTCCAAAATACTTCAGATTTGAGGAGAGAAGAGGAGCAAAG
CCTTGACATTGAAATACGAGGTGGGAAAGTGGATGCTATATGATCTTGAAGATGGTCATG
GAGATTTTGAAAACTGGCACACCTTTCTCCATGTTTGGCTTTTAAAAAAACTGAGTAAAT
CAAACAATTCAGCCTTAAAGACAGAATCATGGGAATTGGCTAGAAATGCAAATTTTCAGG
TCACGCCAACATCATATACCAGTTTAATATCTAATGTACTAAATAACCCATGTATTCCTA
GAATAAGAGCAAAGTAGATTATCCTATTAAACTAATGTATTTATGAATTCAAATAAAGAT
GATTTTGAAAAAAAAACTACACTGAAATATCATTTTGCACTTTATAGAATGGCCATTATT
ACAAAAACAGAAAATTACATGTGCTAGAGAGGATGTGGAGAAATAGGAATACTCCTTCAC
TGTTGGTGGGAATGTAGAATAGTGCAACCTTTGTGGAAGACAGTTTGGCGGTACCTCAAG
AAACTAAATATAGAACTGCTGTATGACCTAGCAATCCTGTTAGTAGGAAAATATTCAGAA
CTAAAAGCAAGGATGCGAACTAACATTTGCACACCAATGTTCATAGCAGCATTATTCACA
ATTGCTAAAATATGGAAACAACTCAAGTGCCCATCAACCAACAAGAGTAGATAAACAAAA
TATGATATATACATACAATGAAATGCTATTCAGCTGGAAGAAGAATTGAAATTGGGGTGC
ATATGACAACATGGGTGAACCTTGAGGACATTATGCTGAGTGAAATAAGTCAGACACCAA
AGGACAATATTGTTCGGTCTCACTAATATGAACTAAAATAAGTAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved