Dasypus_novemcinctus Locus Mono:79:SNORA26
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:79:SNORA26
Dasypus_novemcinctus
Mono:79:SNORA26
scaffold_792
SNORA26
1001..1130
2130
CATGCGCAGTGCTGATGCGTGCAAGGAGTGCTGGCCCATGCAGGGGTGTCCCCGCATAG
GGGAGCCCCACGTGCAAGGAGTGCGCCCTGTAAGGAGAGCCACCCAGTGTGAAAGAAAGT
GAAGCCTGCCTAGGAATGGCGCCACCCACACGGAGAGCTGACACAACAAGATGACACAAC
AAAAAGAAACACAGATTCCCGTGCTGCTGATCACAACAGAATTGGACAAAAACAAGAACA
TGCAGCAAATAGAACAGACAACTGGGGGGAGGGGTGGGGGGAAGGGGAGAGAAAGAAATA
AAATAAATCTTTGAAAAAAAAAAAGACCCAATTCCAAATGTTACAATTGTGTTTGCTTTT
TTTTAAGGGATTTATTTTATTTACTCATCCCCGCCCACCTTGTTCTTTGAGGTCGCTGTC
TGCTCTCTGTGTCCATTTGCCAAGTGCTCTCTGTATCTGCTTGGCTTCTCTTTAGAAGTC
ACCGTGAACCAAACCTGGATCCTCCCATGTGCAAGACAGGAGCTCAATCACCTGAGCCAC
CTAAGCTCCCTCACTTTGTTGTGTCTCTCATTGTCTTTCCTCTTTGTATCTCTTTTGTTG
TGTCATCTTGTTGCATCAGCTCGCTGCACCTGCCCACCATGCCAGCTCACCTTCTTCAGG
AGGTACTGGTGACTGAACCCAGGACCTCCCATGTGGTAGGCGGAAGCCCAGTCATTTGAG
CCACATCTACTTCCTACAAATGTGTTTTACTTTACCTTTTCCTGCATGTATAATCAAATA
TGAAAGTCTGTTGATCCTACCTCAACAATATCAAATTAATACTCTTTCCATTTCCGTTGC
TACTTTCTGGTTCAAGTCCTTTTAACTTTTGATGTGATTGTAAAAAAATTTTGTCCAATT
CTTTATACCTTTAGTTATACCTTCTCTAATCCGCTAGTGGTTTTAAAAAAATTAGCAATT
ATATCTTTTTTCCCAATAAAAGTGCATGTTTGCTCTTTCCTGTGCCCTTTTAAGATTGAT
TCAGTGCTTTAAGTGGCTAATATAAAAATGTAGAAGGGTAAATTAATTCTCCATAAAACC
CAGAGAGGAGATTGTAAAACTTCATTTTGGATCCTGTCTGGAGTCACAGCTGAAAGATAA
AGTTCATGTGGAAATTATAATTATATACAAAAATGAAACCAAAGCTATTTTTAGTTAAAT
TAAATTAAAGTGCAAAATGAGGGAAGCAGACTTGGCCCAGTAGATAGGGCGTCTGTCTAC
CACATGGGAGGTCCACAGTTCAAACCCCGGGCTTCCTTGACCCGTGTGGAGCTGGCCCAC
GTGCAGTGCTGATGCGCACAAGGAGTGCTGTGCCACGCAAGGGTGTCCCCATGTAGGCGA
GCCCCAGGCGCAAGGAGCGCACCCCATAAGGAGAGCCGCCCAGCGTGAAAGAAAGTGTAG
CCTGCCCAGGAATGGCGCCGCTCACATGGAGAGCTGACACAACAAGATGACGCAACAAAA
AGAAACACAAATTCCCGTGCCGCTGACAACAACAGAAGCGGACAAAAAACAAGAACATGC
AGCAAATAGACACAGAGAACAGACAACTGGGGGGTGGGGGAAGGGGAGAGAAATAAATAA
AATAAATCTTTAAAAAAAAAGTGCAAAATGAGGTGTTCTCATTACAAGTGATCTTTTACT
GGTTTCATTTTTAACTTTGTTTCTTTCATTAAAATCCAGTATGTGCCAAATCAATTTGAA
ATGATAGAGTAAACTGCATATCTGAAAAAAGTTAATAAGGGTGGTCCTACCTTATTGCTT
TTCTTCCCTCAGCATTTAGCTGGCCATCCTTGCATGTTCAATTTTCCATATGAATATTGG
AATCAATTTGTCCAGGTAAAAATAAAACAGAAATAAAACTCAATTGGCTGACATTTTTAT
TTGTATTGTGATAAATTTACATATTAACTTAGGAGAAAATTGACATCTTGATGGCATTGA
GTCATCCTTTCTATGAACATGTGTTGACATCTGTCCAAGTGTCTTTTCATGTGTGCATCA
GTAGTATTTATAGTTTTCAGCAAATAGGCAATATATTTCTTCTAAAATTTATTCCTAGGT
GTTTGTTATGATTGCGATTTGAAATGGGATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved