Dasypus_novemcinctus Locus Mono:372:SNORA18
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:372:SNORA18
Dasypus_novemcinctus
Mono:372:SNORA18
GeneScaffold_3641
SNORA18
1001..1129
2129
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTTCTTTTCTTTTCTTTTTTTCATATC
AGGCGGGTAATGTGCTGTTGTAACAAGGTTTGAGGGAGGCACATCTCACACAAATGCGTG
AATACCCATTCATCATGCTTCCGAACCACAAAAGGATCCACGTTTCTTTTCTATTCGGCT
CTCATCTTTATTGTTTCCTTCCATCTACTTTCTCTGGGTTTTAACTTTTTAAAAAAATTT
TTTACTAGGTTTACAGAAAAATAATGCAGAAGATATAGAAATGCCGTATACCCCCACCCC
CCCACCCTTAACACACAGTTTTCCCTGTTTTTAATACTTTGCACTGGTGTGGTAGCTTTG
TTGCAATTGGTGAAACAATTATAATTATACGATTCATTATATATAGTCCATAGTTTACTT
TAGAGTTCACTGTTTATGTTGTACAGTCAATTCCAGAACCATATCCTGGATGGAACTGGT
AGGCAGGTGAAAGAGTCTCATATAAAAACTCTACCCAAATGGAAACAAATGAAGCAATCA
GATACTTGCTCTCAGGAATTGGAATTAAGAAATACAAAGAGGCTGAGGTCTATCCCGATG
GGGTCTCCGTAGACCCACATCATTGAAAACGCCTCACAGAGGAATGTTGTGGTTCTGCTT
TACTCACAGAACTATTTGTTAGATCTGTGAGAAGGAACTACAAGACAGATCATTGCTAAA
AGTATGAAAGATCTAACAGTTCATTTTTTAAAAATCCTATAGGTATTGGCATATCCCACA
GGTCTCTACTCATCTTGGGTGTGGTAACGGGAGTGAGTAAAATGAAGTCATGATGAGTTT
TTCTAGGTTGTCTGAAGTTATGAACCATGCAGATCTGCCAATTCATTATTCTAAGTAAAT
AGGTGGGCTGTTTCTGAATGAAGCATACATCAGTTTGTCCACACACAAGTGGAGATGAAA
AGAAGCCCATCTAAAAGAATTATGACAAGGCTGATTGGAAACAGTTGTGGATTCTTTCAA
GAGGCTATCTTGAAGATAAATCTTGTTTCAAGCTTCAGAGGAATTAAGTTGGTTTTGATA
ATTAAGCAGTGGAATGATCACATGTTGAATTCTGTAAATAAAAGATTTTTAAACTTAATT
TGCTACACATAATAAAAGTACTTTTTACACTGTAAAAAAAAAAAAAAAAGAAATACCAAG
AGAATAGAACTGAAAACTTAAACTAAAATGATGTGCTGGGAGAAAACAAAACAGAATGAA
GCCTATATAATTGTACATAAGTTAATTTATAAATAAGCAGAAATTATGATGAAGAAATAA
GGAATAAAAGCAATATAAAAACAGAAGATAAACTCTGGTGGCAACAGAAAGAAAAGTAAA
TAGAATACGGAGAATATCTGAGTTATACAAACAGCAAAGCATTAGAGAGAAGATGCAGAC
TTCTGTTGAATTCCTCTATGCTGTCCTAGATTGATTTATAATTCAATTCAAAAAGGTCTG
GTCATACCACAGGTTCCTGCTCTTGGATGTCTCTGGATTTTCATTTCTCTATTGCTTTGT
ATTTTAAAAATAACATTCAGCTTCTTTTAATAGCCTAAATTGAATTTGTTCCTTATACCT
AAAAACAAACAAACAAACAAACAAAGGGAAGCAGACTTGGCCCAATGGACAGGGCGTCCG
CCTACCACACGGGAAGTCCGCAGTTCAAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved