Dasypus_novemcinctus Locus Mono:94:SNORA70
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:94:SNORA70
Dasypus_novemcinctus
Mono:94:SNORA70
scaffold_35765
SNORA70
1001..1125
2125
TACATAAAATCTCCTGTTGGTTCTCTTTTCTTTCCCTGGAAAACCCTGAACAATATGCC
AGACAATGCTCAAAATTTACACTGACGTTTAACTAACTCGCTCAATCGTAACACTCCTAT
GCAATAGGTAAAATTTAAATGTCCATTTTATGAAACGGAGGCACAGCATGGCTAGTGACT
TGCTCAAAATAGTGTAACTATTCAAGGGTCAAAGAAATTTTAACCAAAATAGCTGGACTG
CAGCATTAATTCATTTCTTTCTCCTGCATTCCTTATCCGGTTAATACTATCTTTTTCATA
TGCCTCAAGATCTGGCTCCAATCTAGCCTCTTTCTTCTATTATGACATCCTCCAAGAACC
TTATGCTGGGAGCAGATATGGCTCAATTGCTTGAACAGATATTCCACATGGGAGGGCCTG
CATTCAGTTCCCGGTGCCTCCTGAAAAAATAAACCAAAACAAAAAACAAACAACAAGCAA
AACAAATGAAAAAATCAACTCAGGAAAGCCTATATGGCTCAGTGGTTGAGCACTGGCTCC
CCACATATGCAGTCCCAGATTCAATCCCCGGTCCCCAGTCCCTGAAAAAAGAAGAAAGAA
CCTCATGCTTCATCTCAACTAGATGACTCCTTACTTCCCAAAAACAGTTTCAAAATTGTC
TTTTTGGTTCATATATATTTATATGTATGGATATATACATAAAAATATATTTTTGAAAAG
GTGAAATTATTAGTCATACAACTATGAAATGAACAAGTGCCAACATTTTCACTGAACTTA
TTAATTCATGAGGGAAGCCTGTAAGATGTTATAACTGGGTAAAGGAAAATTCGAAGAGAA
GATACATAAATATGCTATAATGAAGGCAGAAATTAATTTGTTGACTAGGTGAAAAACTGA
TCAATATATACAGGGCAACAATCATTTGCATCTCCACTGTACGCAATTTGCAGTTCTATA
GATGAGAATTGTTTGCATTATATCCAGTTTTCTACAATTTACTGGAGTTATAAAATAGCT
CAAAGGCAATGAAAACTGTGTGCAGGAGCTGCGTACCACAGCCGCCTTAGCAGTGGAGGC
AGCCTGTTACTTGTAAGAGTTGCCCTGGGAGACTTTGAAGACAGCACTTTCCTGTTGATG
GTCATGTCTGACCTCCTGCCATCCCCAGTGTAGCCTCCAGACAGGTATGCTAAGTGCCTT
TGGAAAGCCCCAGTATGGTAGCCAGGGTCCACATGGGCCAAGTCCTCACGTCCTTCTGCA
CCAAACTTTAAGACAAGGAGCATGTGATTGAGGGGCTATGTAGAGCCAAGTTCAAGTTCC
CTAGCTGCTAGAAAATCCTTATCTCCATGAAGTGTGGCATTACCAAGTTTAAAGCTGATG
AATTTTAAGACACAGTGGCTAAAAAGTGCCTTTTCCTGGATGGTTTTGAGATCAAATACA
TCCCCAGTTGTGAGTCCTTGAACTAGTGGCAGACCCTGCATGCATGAAGGCTTTGCCAGC
ACTCCCCTTACCTGACTTGTGCCTACTAATAAACTACCTCCTAGCTGTCAGAGAAAAGGA
GTGGGGCAAGGGGGAAGGCAATGAAAGGCAGTTTGCTAAACTGGACACCAAGAAATTTTT
TTGTCCATTTCAGTCTTTCACAATTTTTCCTGGCAATACTGATTCCTCAGCTTGGAATGC
AATCCACTGAAATTCTATTCATCCAAACAGTACTTACTGAATACCTACTATTTGCCAATT
ACCATGCTAAGAGCTAGGGACTCAATGGTGAGTTCAAAAAAGCCATCATGCCCGTTGTAG
TCATCTTTCATAGGTCAGCTCTAAACTCACTTCTGTGATCCACCTATCATGGTTAATCCC
TCCTTTTTAGCTCCCATGTAATCTTGAGTACATTGCCATTGTAACATTGGTAAATACGTC
CTTCTACTATACTTAGCAATTAATTTTCCCCACTAAATATCCCCAGTAGGTTTCCCACTA
GATTATCATTCTGAATAGCAGGATACATGTCCCAAATTCTGCATCTTTTGTATAGGATAA
TTTATCTTTCTTTTCTTGAGCAGATACCTGCTGTATATAAAATACTGTGCTACATGCTGC
AGAAAGATGATTAATTCAACAGAGGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved