Dasypus_novemcinctus Locus Poly:8:SNORD113
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Poly:8:SNORD113
Dasypus_novemcinctus
Poly:8:SNORD113
scaffold_71091
SNORD113, SNORD113, SNORD113
1001..1075, 2086..2155, 3518..3592
4592
TGAGTCTATAGGCAGATTTCAGGAATATACAAGGATCTTGTTCCTTTACTTTCGGTTGA
TAGATTTATATTCTTTTTTTTTTTTTCCTCCAGATGTACTGGGGATTGAACCCAGGACCT
TCTATATTGGAAGTAGACTCAACCACTTGAGCTGCTATACCGCCCCCAGATACTGTTATT
ACAAATAAATCATCCCCTAGACTCTATTATGATTAATAAATCAATGACAGAATATTCAGC
AAATATATAATCAGAGAAGAGGATCAAACACTGAGTGTTAAGAACATGTTGTGAGGCAAG
AAATCCGATTACTATATTTGGATTCACTGATGCTCATTAATGGCTATAGGGTATTACTTC
TTTGGTTAAGTATGTATAGGTGTTGATAGGTAATAGTAAATTTTATTGATCTGAGCCCTT
CTCAAGTTTGTAGTTGTTAATTTTATTAAGAGAAAATATATACCTATTGTGACATTAGTA
AATACCTAAATCATGAGTAAATGGAACATGGAAAGCAAGGACCCATTGATAGAATGTCTC
AGTCCTTTTATCATCTGCTGCGCTTTGTCTTTCTCAGGAAGGATGCGCTAGAGCTGATCT
AAGTCTCCTTTCGTAGCCGTGAACTCTATGGTGGCCTCCATCTGTTAGGAACACGGAGAA
CAAAGTGAGTGGTAGTTTCTGTCATTGCTGGAGTCATTTTTAAAGGGCTGTAACTATATA
TTTAAAAGTGTGAAATATAATTTTAAGAGGCTATTTGTGGCTGAGTTATGAAATGGCATT
GATGTGAAGCATTATAGGGACTAACTCACATACACACCACAGAGGCTGAATAAGGACAGT
TCTAGGGTGACAAATCATTCTATTGACAGATGTGAGAGGCATCAAGTTATCATGCTTGGA
TTTTTGAGGATTATAGGTTATTATTTTTACTATTATGTGTGACTTGACGAATTAATCTAG
AAACCAGTTTTAGAAATGCAGGAAGACAAAGCAGGTCAGTCTGGACCAATGATGACCACT
GGTGGCGTATGAGTCACGGACGATGAGTGATACGTGTCTGGACGTCTGAGGTCATGCAAA
GAGGAATCAAGTGTGTTTTCTCTTGATCCTATAGGTAGGTGTTGAAGTGATCTGTAGTAC
ATGTTGGGAATGCACAAAGATCTCATTCTCTTACATTGGGTTCATGGATATTGATTCTTT
TATTTTAACTGAGTCAATGGCGGAATCATTAAACAAATACATAAAGAGAGGGGAATAAGG
TGATGCATTGCCCAACTATGACCATAAGTGGTTAGGAAGGAAATGTGATTAACAAACATT
GAAAACACCACCCAATAAAAAAATGAAAGAATTAAGGACATTATCATTGTCACAAAGGAC
CATAAAGATGCTGATTAGATAGTCATTTTTATTGCTCTTGGTCATTCTTAAGTTTCATTG
AGAATTATGGAATACTTAAATGATTGAACAAATTAAATATGGACAAGGATCAATGGATAA
AGTGTCTCAATCTCTGTATCATTTGCTCTGCTTTGTACTCATCAGAATGGTCCCCCTTGG
GATGATGTAAGCATCTGCTGTGATCTTGAGCTCTCGCGTTGCCATGTGTGTTAGCAGCGT
TGGAGACCAATGTGAGTAAGGGCCAAGTTCTTGTCCTTCTAAAAGGGTATTCACTTGATT
AATAAAAACTGTGTAACACAATAAAAAAGGTCAATGTGGCCCAGTTAATACAGGAATTAA
TTAGAATAGAATCGCTATAAATCATTATGTTTATATATATTAATTCATATATCAAGCATG
GAGGTCAGTTAAAGAAAAAGATCTAGTACTTTTGGGAAATGACCCCATAGATGGACTTTA
GAGATGGTTGGATATATTCTATTTCTGTTTCTGTGGCTCTCATGTATTTGCTTGTTTGTG
TGGAGATACTGGGGAGCAAGCCTGAGGCCTCGTACATGGGAAGCCAGTGCCCCACCATCT
GAGCTACATCTGCTCCCCTCAGGTGTTTATTTTGTTATTACTTGTGACTTTGTGGATTAA
TCAATGAAAATGTGTCGCTAGGCATGAAGAAAGAGAGGGCCAGTCATAGATCAGTGATGA
CCCCTGGTGTTGTATGGGTCATGGACGGTGAATCTTTCTGGAATGCTGAGGTCTATAAAG
TGTTAACTACATCTATTCCCTCAGTTGGAAGTGATCAGGGATATTCAAGGATCTTGTTCT
TTTACTTTGTGTTCATGGTCTTATTCTGTATTTATTTATTTTTCATAAGGGCAGGTAGAA
GGTCACTCCTTCGTTCATTTTTTTTTTTTAAGATTTATTTATTTATTTCTCTCCTCCCTC
CCCCCCCCCGCTTGTCTGTTCTCTGTGTCTTTTTGCTGTGTCTTCTTTGTCCACTTCTGT
TGTCATCAGCGGCATGGAATCTGTTTCTTCTTTTTGCTGCGTCTTCTTGTTGTGTCATTT
CTCCGTGTGGGTGGCGCCATTCCTGGGCAGGCTGCACTTTCTTTGGCGCTGGGCAGCTCT
CCTTATGGGGCGCACTCCTTGCGTGTGGGGCTCCCCTACGTGGGGACACCCCTGCGTGGC
ACGGCACTCCTTGCGCGCATCAGCACTGCACATGGGCCAGCTCCACACGGGTCAAGGAGG
CCCGGGGTTTGAACCGCGGACCTCCCATGTGGTAGGCGGATGCCCTAACCACTGGGCCAA
GTCCGCTTCCCTTATTCTGTATTTTTAAATGAATTAATGACTTATCTGTTATACAAATAT
ATAAATAAACAGAATCAGGGTGAAGCATTGCTCAGCCATGAGCAATTGTGTTGAAGCAAG
AATTCTTATTAATATCATTTGGAAACATGTATACCCATTAAGAAATCAGTGGTTCTAGCT
TGCTACCTCTTTGTCTAATGAAAATATAGACATTGATAAGTAATAGTCAATTTCATTGAT
CTGGGCCATTCTCAAGTTTGTGATTGTTCATTTTTGTGAGGACAAAAATACATAAATATT
TGAAAAATCATCAGTACACAAATGAGTGAATGAAATACAGAAAGCAAGCATCAAGTGATA
GATGTCTCAATCTTTTTTTATCTGCTTTGCTTTTTACTCCTCAGAAAGGAAGTATGAAGT
TGAGAGAAGTATTCTGCCATCGTCACTGGCACCTCGGTTGCCTCGATGTGCTAGGAGCAT
GGAGGCCAATGTGAGTAATTGTCCAAATTCTCATCTTGGTTTGGGTGGTTCATTTCAGGG
TATTGTGAAATATATTCAGAGATGGCTAACAGTGGCCCAGGGATAAAATGAGATTGATAT
GGTGCATTAGATTGACTAATCCACATAAGGAAATGTGTGGATTTCCTGTGTGGATGATTC
CTGATAGAGAGGTATTGATGTACCCTATAGAGAGATTTGAGGTATATCAAGTTGTTGTTC
ATGGGCTTTTGAGACTTTTAGGTCTTAAAAAGTTACAATTAGTGAATTGATGAATTAATC
GATGATTGCACATGAACGGAGAAAAAGACGATCAATTCTGGACCAATGATGACAACTGGT
GGCGTATGAATCATGGATGATGAATGATACGTGTCTGGACGTCTGAGGTCAGACAAAGAG
GAATTGAGTCTATTCAGGCCATTGAAACTAATCCTATTGGTCGATGTCAGGAGTGTACCA
GAAGCTTACTCTTGTACTTTGGGGTTCAGGGATTTTGATTCTATTATTATAAATGAATCA
ATGACAAAACCACTAATCAATTATATAAATTGAAAAGGCAATGTAAGGAGTAAGGCTATG
CATTGTTGAACCTAGTGCATATGTGGTAAAGGAAGAAATGCTTAATGATCTAATTTTAAA
ACATTGATGCCTATTAAAAAAGATAAAAGTGCAGGTGTGTTACTTTTGTGGCTAAGGATT
GCATAGAACTTGATGAGCAAGAGTCAATTTTATTACTGTAGGTGTACTTCCAAGATTGAT
ATTGTTCATTTTTTCATAAGAAAAATGTTATTATGACATTTAGTAAATACCTGAGCATTA
CAATGTAATGTCCAAAGCAATGTTCAATGGATACAATGTCTCCATCTTACTATCATCGAT
CTGCTTTCTACTCCTCAGAAAAGACTCATCTGCCATGTTCCCAAGCTTTACGATTGCCTC
TGACCAGAGACCATTGTGAGTAATAGTTCAAGTAATTGTCTTGGTTCAAGTGTATAATTA
AAAGTGTGAATATCTTGGAAAAGGACCACCATGGTCAAGTGGTAAATGGGATTGATAAGA
AGCATAGTAGTGACATATGAAACACTGAGAATTATTTTAATGAAAGATGTATTGAGTGAC
AAATTAGTCTACAGATAGATGTTAGCTATATCAAGGGTCTTGTCCTTGGGTTTTAAAGAA
TTATAGGTACTTTTTATTATTTTTAGTAAATTGGTGAATAAATCAATGAACAAATGTAGA
AATGAATGAAGAAAAAGGATCAGTCTTGGCTGAATGATGACTAGTAACATAGTGTCATTG
ATGATCATCGATATATGCCTGGAACTCTGATGTCCTACATGAAAGAAATCTCATCTCTAT
GTTGTAAATGATCAAAAAGACAGAATTAGGGTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved