Dasypus_novemcinctus Locus Mono:56:SNORA70
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:56:SNORA70
Dasypus_novemcinctus
Mono:56:SNORA70
scaffold_19197
SNORA70
1001..1128
2128
TGTGCATGAGTAAAGTTTCCATATCTTGTTTTTGCTTGTTGAAACTTTTATGAGAATTG
AAATTGTTTATGGTTGTTTGGTGAATATTGATTGAGAATTGACAGCAAACCTTAGCATGC
CAGTAATCTTGCTTTGTATATTCTTGTTTTTTATTATACAAAGTGGAAAAATAATCAATG
TTTTTAGTCCGTGTTCCATTGCTCTTGTGAGTCGAGACAAATCTAACACCCAAATATCTG
CATAACTTTCCACATGTTGTAGCAGTGGATGCTATTGATTATTTACCCCTGAGAATTTCC
TTACTATATTCATATGAAACAAGATCTAAAAGTATGGGAGTCTTATGGTTTTAGCCCATG
TATAATATGGCCACTATTAATTTTGCATTTCCCCCCTTGACTGTTACCCTTTTAGGTAGG
TCTTTCTGACTTTTACCCTCCGTGCGTTTCCTATGCTTGAGAGTGGCATAATTTCATTTA
ATGTGTGGTTCTGGGGGTCACATCTTAATATCCATTTTCAATTGAAAGAGTTACTTTCTC
CAGTGCTAGTTTTATGGGACTCGCTGCCTGCGATAGTTTATGAGAGAGTAGAGCCCCTCT
GTGGGAGACCGTCGACCAGCGGGAATTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NTGGGGGTGGGGTGGGGTGTGGGCTATATGGGACCCTCTTATATTTTTTAATGTAACATT
TTTTGTAATCTGTGTATCTTTAAAAAAAAAAGACAATTAAAAAATAAAGAATATACCCAA
CCTCTCTCCGTGGGGGCCCGGTGTGTGGTGGCTGCCAATAGCAGCTTCCTTAGGAGTGTA
CAAGGCCTGTTGCTTGTATGGGTTGCCCTAAGGGACCTTGGAGACAGCCCTTGTCTATTG
ATGGCCCTGTCTGTGACCTCATGCCATCCCTAATCTAGGTTCCAGATGGGTATGCGAGGT
GCCTTTGGAAAGTTTTGGGATGGTGGTCAGTGTCCACATGGGCCAAGTAGTCATTTCCAT
CTGCACCAAACTTCAGAACAAGGAGCATGTAATTGAGGTGCTGCACAGGGCCAAGTTCAA
GTTCCATGACCGCCAGAAAATCCACATCTCCAGGACGTGGGTCTTCACCAAGTTCAGTGC
TGAAGAATTCGAAGACATGGTGGCTAAGTAGCACCTCATTCCAGATGGCTGTGGGGTGAA
GTACATCTCTAATCATGGCCCCTTGGACAAGTGGTGTGCCCTGCACTCACCCTCACGAGC
ATTGCCCTTACCTGACCTGTGCCCTCCAATAAAGGATTTCTAAAACAAAACAAAACAAAA
CAAAACAAAACAAAACAAAACAAAACAAAAAGAACAGACCCAAGATTGTTTTTAAAAAAT
ATCGAGTTCTTTGTCTAAGTCCAAGATCATTGAGTAGGTTGGGGTATGGTTCAGGGACCC
ATATTACTTTTTAAAAAAAGATTCTCACTTCACCCTTATGTGCAGCCACATTGGGGACCT
CTGAATGGAAGAGTATTAGCTAATATCTTTCTTGTTTGTTATGACCTAGTTCACAGTCGA
TATTGTAAAATGCTGACTCTGTGAAATAAAGTGGGATTCATCAAAAAAGCCTGTAAGTTT
AAATGTCATATTCTCTCTTGTCTTAGTCTAGTGTAGATAGATATGTGATTAGCTTTAAGA
ATGATGAGCTTGTAATGCAAACAGTTTCTTTTAGTTCTGAATTATTTAGATAGATTCTTC
ATTATGCTTTTATGGGTAGTTTTAGGCTTTGCTATTTTCTAAGGTTACTTTGGTCATCAT
GTTAATACAATTTCTTTATCCCTGGTGAAATTATATCATATACTACCTAGTTCAGGATTT
CTCTTTACTATATAGGACTATGTAGGACC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved