Dasypus_novemcinctus Locus Mono:387:SNORD74
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:387:SNORD74
Dasypus_novemcinctus
Mono:387:SNORD74
GeneScaffold_4479
SNORD74
1001..1080
2080
TGCTTTTTTAATAGAATTAAATGCAGACCATTCAAAATAGGACAAAATGAAACTTGCCT
TTATATCTGCTACTTTCATTGATTGAAACAGCAACTCAGGTAAACCTGTAGGGAAGATAT
TTTACTCTTTATTCCTTGGCACTTCCTGGCTTAGAGAATAAACACCCTGAGGATTGCATT
TCCAAAGGGATATCCTGGACTTCTCAGCAATTCTGAAGGATTCCAAAGCAAAATTGAGGT
TAAGTGTGCTTAGAGGTTTTAAAGGTGATGAGAAGAACCATTGGGCCACAGGAGGTGCAC
CAGCAGCAAGAGCTGTTAGATTTTTCCTCTGACATCTTGGAAATTCCTGTTGATATCCCA
GAGAAGGAGATGATCTCTTTGCTGATGTCTCCCAACCTCCTCAGTTGCCCCTTNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNAACCTCAAAGTTGGGAGTGATAGGGTTGGGGATGCC
GATACTTCCTGAGCATACAGTACACCAATAATGGTGGTGAAGTAGGCACCCGTCCCATGG
CCATAGACTGTAGTCCTCATCCTCATTATTGTCTGGCCGCTGGGAAACCAGGCAAGCATG
TAGAGAGTCCATCAGGACCCCTCAGCTCTATGAAAAAAAATCAGCTTAGTCTTCTCTCTT
TCAGTCGTGATATCCAGGTAAATAAGAGTCTGGCAGCTCACATGCCCTGCCTCTAATGAA
GCCAATGTTGGTAGGGACATCTGACGACAATGATGAATGCCAGTAGCTCTGATGGTGGCG
CATGGGCCCATGTAGCCACAGCCTTAGGCTGCGTGCACTGCTGGGAAAGGCCCCCTGTAG
TTGGATAGTGCATGTGGTTCTCTAAATGACTGCTTAGCACTGGGCACCATTATTTAGGGA
TGCCTCTAGGCATAAATGGAATGTGGCTTTTCCTGGAATATTTTGGACAGTTATATGCCA
AAGATGGATGAGCAACTGCTGAGGTTCTAAAGCCTCAGTCAAGCCTAGGCATGAGGAAAC
AGGCAGACCTGAGTCTGACCTGTCTCGGCAATTTTGTATTTGGTCCGTGGTAGACATTTT
ATATCCATGTTCATCCACTTACAGCTTGCTTGGGTCTAGAGGCAAACTTGGCAGCAATGG
ACGGGACAGTTTAGAAAGCACAAGGATTAGGAATTCACCTTTGTGGATAGCACAGGTAGA
CTTCATTTACCTCAAGGTTTCAAGGATTTTGATGACAGCCCACCACACAGCTCTTAACAT
TTGGAAGACAGTTGGATGGATACTCACAATACAAGAGTAAACAGTCTGAGTTTTAATTTC
TATAAACTCATCTGGAGTCTAATAAATTTCTGTAAGCCAAAAAAAAAAAAAGAGTCTGGC
TACTTCAAGATTTCTACCTTGGTGTTGCTAAGTGCTTGCTGGGTTGGTGAAGGACAACAA
GGTACTTTAGAAATTATAACCTGGAAGCCCTTAGACCACATCTAGCTCGGAGAAATGTTT
TGTTTGACCCAGAGTTTGTAAAAGCAATGAAAAGTATTGCCCACATTCTTTTTTTAAATC
AGGAGATTTGGGATGAAAATTTGCACTTTGAGCTCTCTTTAAAATCTAAAGGAGTAGGAA
TGATGTTTCTGCAATTTCTTACGACAAAAATCATTTGCCACCTTTGGACAAGGCATTTGT
TTTACTGTTCACCATGGTCCCTCCTTGCCCTGTTTCTCTAAAACCAATCTACTTTATTCA
TTTTTCTTTCCAGCTCAGTCTCTGTTTGGTCTGGTTGGAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved