Dasypus_novemcinctus Locus Mono:120:SNORA25
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:120:SNORA25
Dasypus_novemcinctus
Mono:120:SNORA25
scaffold_43679
SNORA25
1001..1133
2133
GTAACTCAATAATTTTAAAAAGACAAAAAAAATAAAAATGTGCAAAGGACGCTCATTGA
TGTTCATAGCAGCATTGTTCACATTTGCCAAAAGATGAAACAACCCAAGTTGTAAATGTA
TCTGTTGATCGACATTTGGGTTATGTCCACTTTTTTGGCTATTATGAATAACGCTACTCG
AAACACTTTTGCACAAGTCTTTGTATAAGCATATTTTTCTCACTCTCTTAGGTACATACA
TACAAGTGGAATTGCTGGATCCTACAGTAGCTCTGTGTCTATCTTTGGGAGGAACCATCA
AACTGTTTTTCAAAGCAGCACAAGGTGAATTTTGAATCCTTGATATTGAGGGGTTGAAGT
AGAGATCAAAATTCAAGACCAGAGAACAAGGCTTGCAAGAGGATGATGGCAGAGAGGAGA
AGACAGGCTAAGGAAGAAATTAGTCACAGTCACAGGAGACCCCTGGGAAAACTTCCTCCT
TCATTTGCTCTGGGTCTGCCCTTCCTGAGGATTAATGGAATATGCAAGCCCTGCTCAACT
CACCTCACAGGACTACTTTGAAAGTCAGTTGATGGGATGAAGGTAAAAGCACTCCGACAA
AGCAGAAAGTGGCATAAAAATGCTTTCTAATCTCCACAGAAATACCCAATTGCAGCATGT
TTGTCTCAATAATGCTGGCTTTGTACAAATGGAGCAACGAAAACTGTGCTGCTAAAGGAC
CAAAGACACAGGACCATAGGACCTGAGCCCCTCCACAGAGCTTGCTGAGAACTGGAGACC
AGCCTATCTCCCTGTTCCTTTGTGGAAGAAGCCCAGTGAAGAGAAAAGCCTTTCACTGGA
CCAGTTAGCTAAGTGGAAATACTATTGACCAAAAAGTAATGGTAGGAGAGTGGGTGCACC
TCCGTGGATGAGTGTCTGCTTTGCATTTGAGGTCCTGGGTCAATTCCCAGCACTTCTAAA
AAAAAAAAGAGGGGGGGGGCGGGTAATGGTAGATGGTAGACAAGTCATTTCAAAAGGGCT
TGTGGGACTGAAACCAGGAGCTCTTAATGCTATGACCAAAGCTCGAAGTCCTCCATAGGA
TGACACAGACACAATTGTGCAGTGCTTTGCTTTTTTCTTGAGGGAGATACAAAATATAGC
CAATTCACTGACACAAGTCATACATAGTCCATGTTTGGGATGTGGATAAGTAAATAAATG
GCCCAAAGTTTTTTAAAAAGGTAATGGTTTAAAAAATCTTAATGGTAGAATCTATATAAT
AATCTCAAAATATAAAGTTCTTAAAAGCTGGCAGGGATTGCTAGGGGAGCACTCAGCCAA
CTTCACCATGATTGCAATCTCTCCAGGCGTCATGGGAATTAGGATTGTACTGGAAGCAGG
CTCCAAAGACCTGGAGTTGGCTCCTTAAGGTTATCTACAATGGCACCCAATTCCACAGGG
TCATCAAAGACTTCTTGACCCAGGGAGGTGGCCCAACAGGGACAGGTCAAGGAGATGCAT
CCATCTATGGCGAGCAGTTTGAAGATGAACCCCATCCGGGCTTGAAACTCAAGGGGGGTG
GAGTTCTCACAATGGCAAATGCAGGACCAGACACCAAAAGCAGCCAATTCTTTATGGCCC
TGTCCCCCACCCGGTGGCTTCATGGCAAACACACCATTTCTGGCTGGCCTGCCAGGGCAT
AGGAATGGTGACTCCAGGGGGAATGGTAGAAACAAATTCCCAGAACCACCCTGTGGACAA
TGGGAAGATCATCAAGGCATACCCTTCAGGGTAGATTGGCTGCCCTCTTGGCCAGATACT
TTGGGTCCTCTGAGATGGTCCTTGAACCAGCTCCAGANNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNATTGCTCACTGCAAAGTAGCCCTACTGCTCCTTCTT
GTGTGTATCTACACTGATTCACTTGGAATAAAACGAAGCAGGATGTGTCTCTCTGAGGTG
TCTAACCAAACTTCTTCCCGGGGAAAGTTAGATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved