Dasypus_novemcinctus Locus Mono:149:SNORD36
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:149:SNORD36
Dasypus_novemcinctus
Mono:149:SNORD36
scaffold_57731
SNORD36
1001..1082
2082
AAAAAACAAAAAACAAACAGGAGAGGAGAGTGTAAGAACAGCTAAAAAAGATAAAAACA
GAAATAAAAACAACCTATGGGATACATAAACCTAAAGAAAATATGACTAATGTAAGTAAA
TCCTTTACAGTAATAACACTGAATCTTAATGGATTAAACTCACCAGTCAAGAGACACAGC
CTGGCAGAATGAATAAGGAAATATATTCCATCCCTATGCTGTCTACAAGAAACCCACCTT
AAACCCAGGGATGCAAGGAGACTGGAAGTGAATCACTGGAAAACAATTTTACAAGCAAAC
AATAACCAAAAAGGTGCAGGAGGAGTAACTATACTAATATCAGGCAAAATAGACTTTAAA
TGAAAAACTATTGTAAGAGACAACAAAGGATGCTATATATTAATAAAAGGGATACTCTAT
CAAGAAGAATAAACAATCCTAAACATTTATGCACCTAATCAGAGTGCCTCAAAATGCATG
AAACAAACACTTGAGAAACTAGGTGGAGAAATAGATGCCTCTACAATTATAGTGGGGGAT
TTTAGTACACCATTATCACCATTAGATAGAACATCTCAACAGAGAATCAATAAAGAAACA
AAGACTTTGTATAATACATTAGAGGATCTGGACCTAATATGCATATACAGAACATTACAC
TGAAATACAGTGGGTTATATATTCTTACCTAGGTCACTTGGATCATTTTCCAAGATAGAT
CACATGCTAGGCCACAGAATAACTCTCAGTGAATTCAGAAAGGTTGATATTATACAAAGT
AATTTCTCTGACCATAATGTAATGAAGCTGGAAATCAGTAAGGAGCAAAAAACCAGATAG
GCACAAAGATATGGAAGTTAAAAATAAACTTTTATACAAACAGAGGGTCAAGGAGGAAAT
CTCAAAAGAAATCAATAACTACCTTGAAATGAATGAAAAAGGCAACACAGCATATCAAAA
ACAATAGGATGAAACAAAAGCCGTACTGAGAGAGCAATTCATTGCCACAAATGCCTATAT
TAAAAAAACAAAGCAAAAAAAAAAAAAAAGTGCAAATCTATGAGCTTTTTAACCCTGAGC
AATTGCTGCCAAGCTCCCCTTTAAGTTACTGCTTTTGATCAAAATATACCCCAGAGATGA
TGCTGTCTTACAGCTGGTTGTTTTCCTGTCTGCCTTGTTCCCTATTGCATCATCAAGGGA
AAGGTCAGGCTAAGATGGCTTATCCACAGAAAGACCTGTGCCTCGGTTACCTTCATGCAA
GTCAGCTCAGAAGACAAAGGAGCACTAGCTAAACTGGTGGAAGCTATGAGAACCAATTAC
AATAACAGATACAATGAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTCACAGTCAATGGAGATTCACA
CAGTAGCTGAAGGGATATCATTATTCCCATTCTGGGGTGCCTTGCCACATTCTCTAATGT
AACAGTAAGAATCCCCTGGGTACAGGGGCAATGACTAGTGAAGGAAGATGGTCTATTGAT
GGGTCCTTGATATTGATGACTGTGATTGTATACCTTTACTCCTGAAATTTAAACTTAGCC
TAGTATTACAGTGCCTAAGAATTACTTCCTGAGAGGATCCTAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved