Dasypus_novemcinctus Locus Mono:308:SNORA48
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:308:SNORA48
Dasypus_novemcinctus
Mono:308:SNORA48
scaffold_205679
SNORA48
1001..1137
2137
AAATACTAATAAACTAGAGAGATAGAAATGGAATAGCAGCATAGCAGCTCTGTACAGTA
GGGGAAACAGAGACTGAGAGGTGATGAGGTTTTTTTGTTGTTGTTTATTATTATTGAAAT
AATGAAAATGGTCTAATAATGACTGAAGTAATGAATGCATGACTATGTGATTATAACAAA
TACCATTGATTGTACACTTTGGATGTATTTAGGCTTTATTAAATAATATATATCAATACA
ATTGATTTGTTAAAAAAAATTCCTGCATGGCTTCCTGTTATCCTGACAATATAGTCAAAA
TCCTAGCCTGATATTTAAACCTTTAGTGATTCTTGTCTTTCCAGTTTCCTGTCACTCTTC
CTATCTATCCATGCTTAATTACGTGTTTTACAAATAAATTATGTCTTGTCTTGGGCTATT
TAAATTTTTTCTGCTTAGAATACCTTTTTACTATCATCCATCTTCTTTATTATTTTTCTT
CCTTTGAAATAAAACAAAGTGGCATCTTCTGGGACAATTTTTAACCCCTTTAAGGCATTT
CTTTGTGCACTCAAAGCATACTCTACACACTAACACACACTTATCACATTGCTTATTTCT
TTATTTTCTTTTCTGATTCTTCCATTAATGGCCAAGTTCTCTGGTAACATGTCATATGGT
ATAAACAACATATAAACGTATTTTGAATATATGAATCAGGGAGACAGATGGAGGAATGTA
ATAGCTGAGCCATGCTTCTTTGAAAATATTAGTCTAATTGAGGAACTGAATTAGAGACAT
ATAAAAGTAGCATTTTGTGTGATCTAAGTATCTTTAAAAAAGATAAATAAAAAAATAAAG
TGCAAAATAAAAGCTAAAAAAATATGCAAAAATAAATGAGATGACACAGTTAAATGCTAA
ATCAAAGGAATGGAATACAAATATTGTAGGCATTCAAAGACGACAAGTGATCAGGCCATG
GGACTGTAGGGACTTGATGTTTTGATCTGAAATTTGCATAGTGCCTCCCTACCTGGGTAG
AGTGGCATTTGGTATGGTGGTGCTCATCTCATTTCATCCAGGGACAGAGCAACCCTTTGT
TCATCCCACCTTCGCTTTTGTAGCATGCCTATGCCTGGTTCATGCCTAGGACACACGGAT
TGTAGAAAAGAAAAAAAAATTATATCGTGTCGGATTGCTGGAAGGAAGGAAAGAAGAAAG
ATATTCTAGGAATGAGTGTAACTTAAAATATCTAGAAAGAAATAGGTGAACTGTGATTGG
GAACAGTAAACAGAGCAATCCTACTAGCTTTTTAATAAGGAAACAAAAAGGAAGTTCAGG
CAAGGAAAGGACTTTTTTTTTAAGATTTATTTTATTTATTTATTTCTCCCCATTCCACTG
TTTTTCACTTGTTGTGTCTGTTTGTCTTCCTTATTTCCTTAGGAGGCACTGGGAGCTGAA
TCTGGGACCTCTGTTGTGGGAGGGAGGTGCCTAATCACTTGAGCCACCTCTGCTCTCTTC
TTTTGTTGTGTCTTTCATTATGATTTTCCTCACTGTGTCTCTTGTTGCATCATCTTGTTG
CACCAGCTTGCCATACCTACCTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved