Dasypus_novemcinctus Locus Mono:322:SNORA2
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:322:SNORA2
Dasypus_novemcinctus
Mono:322:SNORA2
scaffold_233141
SNORA2
1001..1137
1574
ATGGGTTTCATTTATAAACTTTTTTGAGTCTCAATATCTTTGACAATGTGATGAAAACT
ATAGCCTCTTTTCCCAGAAGAATTCACATTTACGCCAATTTTTGTATACAATTTCAGTGG
CTCTGAAGCCCACCCATGCTCCAAGGTAAACAATCCTTCCATGTCTGAAGTGTATGGAAA
TCAGTAATACTGTTTATCTGCATTCTCTCTAATAAAACTATTAACTGACTCAAACCAGTA
CGATAGTTACAAAGCCTATTACTCTTGGGAACCCTTCAGGTATTTAAACAACACCAATTT
ACTCTTTAAGTCAGGAAGAAATACAGGAGGAACTTTAGGTACTTTACATACTGAAAAAGT
ATGTAAAAAAAAAAAAGTAGTGGCTGGAAATAAACAGAAAAATGAGAATTGATAGAAGAA
TTTAAAAAATCAAAGCTTTTGGCCCTGAATCAAGGCCAGAAATTTGATGAAGCTGTTGGT
TTCAAGCAGGTTCCTAAAGAAATGTCTTTCTGTGGTCTGTTGGCCATTTCAGAACTTTGG
AAATGTTATAGTCAATTCACTAGAAAGTGATTGGAAAAAAAACCCAGAGCTGTCGAGTGC
CTTTTGCAGTACCAGGCCAAAGCATCTTACAAGCTCTAGTGTTGATTAATCATCAAAGTT
GTTTAAAAATATTTAAATTTTTAGATGTATTGATTTTAAAAAGATAACAAAACAAGAGAT
CCATTTGGGGAAATTTTCCCTCCAAAGTATTTTTTTAAAAGTTCAGATACTTAAAGGAAA
AGTACTCTGAAAAATTCATTATGGGTGACAGATAAGTGAGACATTATTTCCTCTAGTTCT
AGAGACTGGGAATCATTTGTCTCTTAGGACCTTCCCATTACTTTTTTTTTTTAAGATTAT
TATTTTATTTTATTTCTCTCCTCTTCCTGCTCCCTCCCTCTGCCCCCAGTTGTCTGCTCT
CTGTCCACTCGCTGTGTGTTCTTCTGCGTCCGCTTGCATTATCTGGCGGCAGTGGGAAAC
TGCATCTCTTTTTTGTTGTGTCATCTTGCTGCCTCAGCTCTTCATGTGTGCGGCGCCACT
CCTGGGCAGGCTGCATTTTTTTTGCGTTGGGCAGTTCTCCTTACAGGGTGCATTCCTTGC
ATGTGGGGCTCCCCTATGTGGGGGACACCCCTGCGTGGCACGGCACTCCTTGCATGCATC
AGCACTGCATGTGGGCCAGCTCACCACATAGGTCAGGAGGCCCTGGGTTTGAACCTTGGA
CCTCCCATGTGGTAGGCAGATGCTCCAGCAGTTGAGCCAGATCTGCTTCCCTCATTACTT
TCTGGAGAATGTACAGAAGCCCCTAGCTCTTGGGGTTCAAGCTGGAGCCTGGAGAAGGAC
TGAGGGTCATGGCTCTTGGTTATATGTGAATGCAAAGTGCCAAGGCTTCTGGAATAGACA
CAAAAAGTCAGAAAATAAAGCCTTGTAGACAAATTATAAGTGTTGGGATGGTTTCAAACC
CAGAAAACTGGACTTAAACAACCCTTGGTATAATCTTCATCCTCTCTTCTAAGAGGCCCT
GACAGTTCACATCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved