Dasypus_novemcinctus Locus Mono:263:SNORA36
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:263:SNORA36
Dasypus_novemcinctus
Mono:263:SNORA36
scaffold_141090
SNORA36
1001..1133
2049
AATAGAAGGAAATATATTAGTTGAAAGGAAAAGGATAGAAAAATATACATCATGCAAAC
ATGGACTAAATGAAAATGTCCATGGCTATTCTAGTATCAGACAAAACAGACTATAATGCA
AGAAATATTACTACAGATAAAAAAGTATATTTAACAATCTTAAAAGGGCCAATTCCACAA
GAGGACATACCAATCTTCAATGTATTTTCACTTAATAGCAGTGCTTGAATTACTTTAAGT
GCTTGAAAACTCGACAGAACTAAAAGAGAAATACACAAATATACATTTATACATTTAGAG
TTGAAATTTTTAACTTACCTCTTTCAGTAATTAATAGATTATGTAGATGAAAAATAGTGA
GGATATAGAATATTTGAAAAACATCATTCAATACTGTCATTAAATATAATGATAACATAA
AACCATACCTAAAAGTATATCTAAAACCTACATAATACATATTCTTTTCAAGATTTTAAG
TTCCAATGCAACATTTAACAAAAAGGCCATATGCTCAGCCAAAAACCAAGTTTCAAAACA
TTTTAAATTATTGAAATCATACAGATTGTCTTTTCTGACCACAATATAATTAAACTGGAA
AAGATTGTGTGAAAACAAACCCCCAAATGTTTGGAAATGGAGTTTCCATGCCTTCAAGAA
GAAATCACAATGCCAATTAGAAAAATTTGCACTGAATAACAGAAAAAATACAACAGTTAT
AAACTTGAGGGTAACAGCTGAAGCAATTCTAAGAGGGAAAACCATAGCTTTGAATGAATA
CATTAAAAAGAATAATGCTTGAAGATTAATTATCTAAACATTTAAGGAAGTAGGAAAAGA
ATAGCATGTATAACCCAAATAAGTATAATAAATACCAAAAATAAGAGCAGAAATTAATTA
AATAGAGAGTAGAACTACCTTTGACAAAAGGCAATGCCAAAGTTGGTTCTTTGGAAATAT
TAAGTTATTAATTTCCTAAGGAGATTAGTAAAAATATCAGATTCCAAAGCATTGAGTTCA
GTTTAGGGCATCTTCCCTGTTCTGTTCATTAAACTTTGGGAGATTGAAGTGGGCTAGAGT
CAGTGTTTGGATAGAAAATTACTGTTCTATTCATTTATGTCCTGGCCTACAAATGTCTAA
AAAAAATCAGAAAGAAAACACAAATTGTCTGTAATAGGAGTAAGCTGCAATAGGAACAAA
GATCATTAGCGATCTTAAAGATAGTAACATAACACAAGGGGTGACTTTTTGCCTATGAAT
TTCATAAAGAGGAAAGGAAGTAGACAAATTCTTTGCAAAATATAGATTTCCCAACTGATC
TGAGAAAATAGTACTACATTTAAAAACCTCCCGCCTCAATCCCCCAATAATTACAAATAA
AACCAAAAATAAAGAATCCAGACCAAGAAGTTTTTACTGGTAAATTATTTCAACGATTGA
GGCAGAAAAATGTCAATATTTCCCAAATTCTTTCAGGGAATGGTAATGGGAGAGCCCTTC
CAACTGACTGAACGAGGACAGAGTAGGCGGTGTCAGAGTCTGAGGGGGACGGAACAGAAT
AAAGGACCAAGTCACACGATCATTTTAGATGCCAAAGCAGGGGCGTGACAGCATTCATGG
CCCACCTGTAACAACAACCAAGTGCAGCAGCCGCCCGCTACGAAGGCCCTTGGCATTGCC
GGGTAAAGACCCTCCCCGAACCCCCGCAGCCATCGCCACCCCCTCCCAAACCCTCGCTTC
CACAGTGACCGGGGAACACGCCTTCCCACGGAGTCTGGAACAAGATGCCCACGTCCTTTC
TTTCCACGTCTCCCGTGCCTCTGAAGAGCTCAGCTGAGCAGGAAGGCAGGAATCACAGCA
GTCAGGTAAAACTCTCTCTATGCAGATGACGTCACTGACAGGTGAATTTAGTAATATCTC
GGGATACACCGTCAGTTTACACAAATCCATTTTATCTTATCTACTAGCAATGACCAACAA
GAAATCAAAGTCATAATACAATACCCTTTATAATAGCACCTACAATCAAGAAATGCCTAC
GTACGAATCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved