Dasypus_novemcinctus Locus Mono:32:SNORA63
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:32:SNORA63
Dasypus_novemcinctus
Mono:32:SNORA63
scaffold_11566
SNORA63
1001..1101
2101
GAAAGTTTGGTGTGAGAAAAACAATGAATAGCAGGCTATAACAACTTGATTTAATGGAA
CTGAAGAATTTTTGTAATTTAGACTTTATGCCAAATCCCAGTTTTTCCTTTCCAATACCT
ACTCTGCCCATGTGTGAATCTGCTTTGTCTACATGTGAATTATATCCCTGAGATTTCTTG
CAATGCATTAAGATTATAAAAGACAATATTATATATTAAACTTAAAATTAAACATTTAGA
ATGTTAAATATTTAATTTTTACTATAAATTAAGATATCTAATGTCTCTTCAATTTGGTAA
TGACAGCTATTGCAAAGAAAATTGTAATTTCATACTGAATGCTGGAAACAGGTGATGAAA
TTTTTTACCTGTCTAATAAAAGACAATTTGCTAGATATCATTTAACATGCTCTTTTTGTC
AATGTTGTAACGAGACAGAGAATGTAGAACATGTTTTCAAAAAAAGGTTATTTAGAAGAA
GAAATCAGCCCATAAATGATGAGAAAAACATTTGCATAATCTCAGAAGGTAGTTTAAAAT
CATCTAAAGTGAAATTATCTTTTTCAAACCTACTTTAGTAAAAACCCATTTGGACAAAGT
TACTAGTTTATGAATGTCATATATTTACAGACCAACATAGTACAATATCAGTGGGACCAA
TTTAATTACTACCATCTGTAGCTGTCAGAAACATTGCTTACTTAGTTGCACAAGTATATT
TGTTACATGTATCTTTTGATAGTTTTTATAAACCATGAAATAGTGACATAAGATTAAATA
ATATCTCCATATTAAATAAAATAAAAATCAACAAGGAAGAAATATTTGAAAATTGTTTCT
TCAGCTAATTAAACAATACAAATGAGGGTATAATGTATCAGAGCTGTGAAAGAATGACAT
TAAAATAAGATTTAAAGTTTATAGGAAACTATAATCAATAACAAGAATATAGAAATTATT
TGTTCCATTTTTATTCTTTTTGATTAAAAGTTAGACCTTTAAGCAGGATTTAGACTACAA
TATAGCTGTTCAGTGCTGTCTTGTCATTTTATCCCTGTCTGCTGAACTCTTGTAGCAGCC
AGACAGGCTTGGTCTCATGCACTTTAATGGGGGTGGTGGTAAACGTATGCCTTTGGTCTT
GAAATTTATCTAAAGGGGGACATGGCCATGACTATACCAAACATAGACTGAGACATTCCA
ATATATATGGTAGAGTGCCTCTTAGCCCTTTAAATGGAGTATTTTGTAAGAGAATAAAAT
TAAGACAAAGAGAGAGAAAGCCATGGAAGCAAGAAGCTGAATGCAAAGGAACCCAAAACA
GAAGGAAGAGACCAGAAGATGTCTATGTGCTTTGCCATGTGACAGAGGGCTCTGGGATCC
ATGGCAGTCTGTCTTCAGGGAGAAAGCATGGCCTAATGATGCCTTGATTTAGACATTTTT
CTCAGCCTCAAAACTGTAAGCTTGTAAACCAATACATTCCCACTGTTAGGAACCAACACA
CTTTGTGGTCTGTTTTAGGCAACCTAGCAAACCAAAACAGGGAGAAAGTTTATTTTTCCT
TTTTGTTCAGAAGAGAACATTAACAACATGCTTGTATGATGGTAGGAAAGATCATATTTA
TGAAAAAAATAACAATTGTTCAGGAGAAGGAGGTAAAAATTTTTGGATTTTGTCATTGAA
TAGGAAGACAGGTTGGTATAAGAAGATGGGTTGGGATAAGGCAGTCAGGTGCAAGAGTTG
CCTTAATGGGAGCAAGGACTAGTGGTATGAAAAAGGGCAGAGTGCATGGGTAAAGATGCA
TGCTTTTGGTAGTTTGTATAAATTCCCTTCTGATTTGAACAAATTTCTCAGTGAAATAGG
AAGCAAAATCAATAGAAAAGAGTGAAGACTCAGGAAGAGGTATTAGAAATTTGAAAAGGG
AAGGAGATATTTTTAAAAATTCTAGGAGAGTGGGAGGGTATTGGCTAGAAAAAAATAAGA
GTGTGTAAGTATTAATAAATAAGTTGAGAAGTCTGTAGGTTTGTATTTTTCTCCAACTAA
ATTAAGCTAATGTTCCTCAATGTTGAGTAGATGAAGAATTGTGTTTAATCAAGGTTATAT
AT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved