Dasypus_novemcinctus Locus Mono:340:SNORA28
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:340:SNORA28
Dasypus_novemcinctus
Mono:340:SNORA28
scaffold_264930
SNORA28
1001..1127
1648
GCTTAAGCCCATCCAATTCCCTATATAGCAGTTTATTAAGATATATCACAATTCAAACA
GTCTATGCAAAAGTGTATATTCAGTAGCTATTAAGTATAAATCACAAGTTGTGCGTTCAT
CAGCTCGAAAAAGGTTAGAATCATTTCATTACTCCAAAAAGAAAAATCCCACACCACTTA
GCATACTTTACCCAGGGCGTACATAACCACTAATCTTATTTCATTTTCATAAGTTAAGTT
ATATTTATATTTTATATAAATGGAATCATACAATATGTTACACCATATATTTAGTTCATA
GTAGCACAGTCATACAGTATTTGTCCTTTTGTATCTGGTTTACTTCACTCAATACATATA
TTTTCAAAAATTTATTATGGAAAATTTTGAACATGTAAAAGAGTATTCACTCTTATAGGG
AAGCCCCATATGTATATAACCTCTTTTAAGGTTATCAACAGTTATCAACTTGTGGGCAAT
CATATTTCATCTAGTCAATAATATTTTAAGAATGAATGTTGCAAGCAATGCTCTGTGCAG
ATGATTAAAACCATCTGGCACAATTTCTGCTTGCTATAACAAGAAAGTCTGACCTATTCT
GGTGTTCTCTCTTTGACGAGACAAGCCCCATTATATAGACTACACCAGCATTAAAAAAAA
AAAAAGAATGAATGAATAATTAAATATAATTTATGTAAGTGTAGAAATAAATCCTTTTTT
AACAACTTCAAATTTTTCTTTAATGTAGATAAATCATAATTTATTTATCCAATCTCCTCT
TGATGGCTATTTAAGTTGTCTCCAGATTTCACTATTAAAAATTAGGTTGCAACAGAAGTA
GAATATGGATAACTGTTACTCTGTGTACTTATTTTTAAAAATAGCTCCATTGAGGTATAG
TTGATACACAATAAACTGTACATATTGAAAATGTAAAATTTGGTAAGTTTTGACCTCTTT
GTACCTGTGAAACCATTACCACACCCAAAATAATGAACATACCCATCAAACTCAAAAGTT
TCCTTGTACTCTTCTGTAATCCCTTTCTCCCACCCCTCCCTGCCCCCTTGCCCTAAGCAA
CTGCTGATCTGCTGTCTCTGTGGATTAGTTTACATTTTCTAAAGTTTTCTATACATGGAA
TCCAAACATACAGTTATTGCCTGGGCTCTTTTGCTCAGCATAATTATTTTGAGATTTATC
CATTTAATAGTTTATCCCTTTTTATTGCTGTGTAGTATCCCATTGAAAGGGTGTGCCACA
ATTTTAAATCCCTTCATGTACTGACACACTTCTCCAGCCGGGAAGGGTGGTGGAAGTCTA
AGCCTCCCACTCAGCCTCTACTGACCAGCATGGGGGAGGCCACTGTTTTTCTATGGCACT
TGGTTTGGAGTAGGGGGTTCTTGCCTAAAAGTTTTGTCTTGGGGTAGGGGGAATGAGTGA
GGTATCTGGGAATCCCCTATATTTTTGATGTAACATTTTTATACTATGTTTAAAGCTTCT
TTAAAAATTAAAAAAAAAAAAAAAGTTTTGTCTTGCTAGGCTACCCCTTTCCTAGTCCTT
TAGCTAGAGAGAGTCAGCTTTTCTTAGGGAGTTTTTGGGCTACACCTGTTGGTATATCTG
GGTTGCCAGCTTCTCCAGTCTGGGATATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved