Dasypus_novemcinctus Locus Mono:50:SNORA24
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:50:SNORA24
Dasypus_novemcinctus
Mono:50:SNORA24
scaffold_17028
SNORA24
1001..1131
2131
CAAAAGTACTTCAATAATTTCCCCAAGTCAAAGAGCTTGACTGGTAGTCAATGACGGGT
AAGACTCTCAAAGGAGGGCAACCTAAGACAGGCACGGTCACCTCAACATAAACAAAAAGG
GGGAGATATTGGAAACTGAGGCACAGTGGCCTCTCAAGGAGAGATGTGCTGGCTCCATGG
CTACGTTTGCAATCTAAGGAATGTGGTAATTAAGAGTTCCTGGCAAACAGGATGAAGCTG
TGAAAGGCTGAAAGAAAAGATGAGCAGATAACATTTGTGTAGTAAATAGAACACTTAAAC
TTTGTACCTTGAGATAAGATTTTTTAAATTCCTTAGACTATGAGTAATGTTGATGGTTAA
CTGCATGTTGCTGCTTCTACCCATGTGGACTGGGGTATATAGAGAGCCCCTTGTGAACAA
TAAAGTTGTCTGAGGAGTCATCACCCTGCAGACCCCCTGATCCCAGCTTTCTCATTCTTT
CTCTTTGTTTCCTTCTCCTTTTTCTCTGTCTTTCATTCCCGATACCCTTCGGGCCCAAAT
CTCCAACAGGACACACTTTGGTATAATTCATGGTTCACATGAGGAAGTCAGAGGAGAACT
GGAGCAACATTTTAACTGAATGAAGATGAAAGTATAGCATATCAAAATTTGTAGGATGCA
GCTAAAATTTATGGGGGAAAATTTACAGCATTAACTACTTATATTAGAAAAGAAGAACAA
TCTCAAATCTATAATGTAACCTTTCACCTTACTAGAAAAAAAGAAGAGCACATTGAACCC
AAAGCAAGTGGGAAGAAGAAAATAATAGTGAGCATATATCAATAAAATTGAAAACAGTGA
AACAATAGAGATGATCCATGAATACAAAAGCTTTGAAAAGGTCAATAAAATTAATAAATA
TCTATTAAAACTAACCAAGCAAAAAATGGAAAAAAAAAAAAATCCCAGCAATGAAAGAGG
GAGCATCACTACAGATCCTACAGGTATTAAAAGAATAATAGTACCATGTATCCTTGGGAC
CTGTCAGCTATGGCATTCTCCCTTCTTAACCATGGAAGAACATATTCTTGTTTATTGGCA
AAGCTGTCACCATTTAATTGGTATCAGATTCTGACTTGCACAAGTAACATTCTTCACTGT
TAAAAACCTGGAGTGTGCTGAGTTATTTGGTAAGCTTTGCTAACTGTTTTTCAAATGCTA
CTATGAAGCTGGACTTATGCTACTGATGGATGCTAGACAACATAACACATCAAGAAATCC
AAAGGGATAAAGGTGAAGTCTTGTTCAGCATTTTGCTGTGGATTGTCACAGCTGATTTTA
AGTCTTGGATTGAGTCTAATGTTCTGGGAAGTATCAGGACTATATTTTTAATATAGGCCT
AAATATTGATTGTTATGAAATAAAGCAGAGTATTTAAGCAGAAAAAAAAAAAGAATAAGA
GAATTTTATGCCAATAAATTTGACTACAAATAAAATAGACAAATTCCTTGAAAAAATATA
TATGAAAGCTTACTCAAAATGAAAGAGAACTTGAATAGTCCTATGTCTATTAAATTGAAT
TCATAATTAAAAACAAATGGAATTTGTAGTTAAAAACCATCCATCAAAGAAAACCCCAGC
TTCAGATGACTTCACTAGGGAAATCTACCAAACAGATAAGGAAAAATACCCATACTATGC
AAACTCTTCCAGAAAATATGATTGGAGGGAGCACCAAACAAATCAGTTCATGAGGCAAGT
ATTACCCTAATATAAAGAACAGGAAAAACATTATACTAAAAGAAAACTATAGACCAATGT
CCTTCATGAGCACAGACTAATAAATCTTCACCAAAACATTAGTAAATCAAATCCAGTATT
ACATAAATTTCAAGGGTCAAAAACAAAAGCAAAGGAAATTTAGAAATTCAAAAAGACTTA
CGAGACATATCAACCTAAAATTTTATGTTTTAACACCAACAAAAAAAAAATTAGAGAAAG
TTAAACACTTATTCAACCTTTGTCAATAGTAAGAACTTGTCAGTTTCTTTAGTGTGATTA
TGATATTTTGATTAGGTTTGTTGAAGAGTCCTTTAGAGAAACATACTGAAATAGTTAGCT
ATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved