Dasypus_novemcinctus Locus Mono:195:SNORA32
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:195:SNORA32
Dasypus_novemcinctus
Mono:195:SNORA32
scaffold_86801
SNORA32
1001..1128
2128
ATTTTATATTGAAACTTCCCATCCAGAAATATAATATGCCTTTCTGCTTATATCCATTT
ATGTCTTTTTTTTTAAGGAGGTACAGGGATTCAACCCAAGACATGGGAAGCAGGTGCTCA
GCCACTGGACTATATCCATTCCCCATTAGCTTACGTCTTTTAATAATATTTTATAGTTTT
ATAATTTTCTTCACATAGGTATGGTGTCACATTTCATTTAATCCTAGCTATTTATAGTTT
TTTCATTATGTCCATTTCCAGGTACATAGTGCTAAAGTAGAGAAACACTACTGATAATTG
TATTTTTATCTTTTATACAGACAGCTTACAAATATTAATTCTAATAGTACAAGGGTTTCT
TGGGTTTTATAAATAAATAATATCTTCAGCAAAAGGAGTTCTACTTTTTCCTAATATTTA
TGCCAATTATTTTATTTATTACTATATATTTTTAGACCTCTAAGACTATGTTAAATAGTA
ATGTTAACAGTAAGTGTTCCTGTCTAATTCCTGACTTTAATTAAAATGGTTGGAACATTT
TGCCATTACAGATAATACTGCTGGGAAGTGGACTTGGCCCAGTGGTTAGGGCGTCCGTCT
ACCACATGGGAGGTCCACGGTTCAAACCCCAGGCCTCCTTGACCAGTGTGGAGCTGGCCC
ATGCGCAGTGCTGATGCGCACAAGGAGTGCCGTGCCACGCAGAGGTGTCCCCTGCGTAGG
GGAGCCCCACGCCCAAGGAGTGTACCCCGTAAGGAGAGCCGCCCAGCACGAAAGAAAGTG
CAGCCTGCCCAGGAATGGTGCCGCCCACACGGAGAGCTGACACAACAAGATGATGCAACA
AGAAGAAACACAGATTCCCATGCTGCTGACAACAACAGAAGCGGACAAAGAAGACGCAGC
AAATAGACACAGAGAACAGACAACTGGGGCAAGGGGGGAGGGCAGAGAAATAAAATAAAT
AAATAAATCTTTAAAAAAAATAAAATGAAATAAAAATAAAAATAATACTGCTCTGTTCAT
TAGAATGTTGTTTTTGATCTGCTATGGAGGTGACCATAAAAAAATACCCTTCCCACTAGG
TTTTCTTTTTGCTGCCTTGCTAAAATTCAGCCTGTTATAGGGAACATTCTACCCCCATGT
TTTATTTCTGTTGCTTGTAGCGGCACTGCTCAACAGCAATAATGCAAGCTCCGTGTTATT
ACGTAGGATCATATTTAATCAATATGAGATTTTACATTTTTCGTGCTGTAGGTCTTTGAA
ATCTGGTAATGGCTATTGGACAACATAGACCTAGCTGCTTGCAAATGTGCTCTGCCTGAC
TAGTCCCCAGAATAACAAGCCTTCCGGGCTGCTATTAACCATGTATTATGTGTATGTAGT
AGAGCTAGCAGAAGGAAGCTGGCTTCAAAGCTCAACCTAGATAACTACGTTATAATTTCT
GGAAACAACCTTTATAATCTTGCTATTATGTAGGCCTGACAACAGTTGTGGATTCTTAAG
ACTGAAGATAGGAGAACAGGTGTAGCTCGGTGGTTGAGCACCTGCTTCCCATGTACGAGG
TTCTGTACCTCCTAAAAAAAGGAAAAAAAGGCTGAAGATAAATCTTGTTTCAAGCTTCAG
AGGAGCTAAGTGACTTTGATGAGCAATGGGATGGTCCTAACATGTTGAATTCCTTAGATA
AAAATTTATTGAAGTCGTAAAACATGGATGAACCTGGAAGACATTATGTTGAGGGAAGCA
AGTCAGACATAAATGGACAAATACTGTATGATTGTGTTACTATGAACCAAATAAATTGTG
TAACACACTGTGTGATTCAAAAAAATTTATATGCATCTAGTACATTTAAATGAGATATGT
GTTTTTATCAACTATGTTTTCTTTTTCGTTTTTAATTGTTTATATTTTCCATTATTAAAT
GTACAAAATAAAGTTAAAAAAAGAAATAAAAACAACATATGGCATACAGAAACCTAAAAA
AAAATTTATTGACTTGAAATATTGCTTGATGCTACACAAAACAAAAAAAAATATTATTCT
GTAAATTGATTCTCTTTATTTTTTATTTTATTTTTAAAGATTTATTTATTTATCCCCACA
CCCCGCCATGGCTTATTTTTTTTTTTACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved