Dasypus_novemcinctus Locus Mono:139:SNORA32
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:139:SNORA32
Dasypus_novemcinctus
Mono:139:SNORA32
scaffold_53368
SNORA32
1001..1124
2124
NNNNNNNNNNNNNNNNTCTCCATCTCCTCCAGGCCTCACTGCTAGTTCTGCTTTGCGGT
ACTCCATTTGTGGCTTTTCTCTCCTGGGTTTATTGATTTCTGGAGGCTTCATTCTGTCAC
TGTGCCCCCCCCCCCCCGGCCCTCCCCGTCCCCCCATGTCTTTCTGCACATTTCTCCTGT
TTAATAAAGAACTCCAGTAAAAGGATTAAGACCAATTCTGGGTCATACCTTACTGAAGTG
ATCTAGTTAAAAGAAAGGGCTCTTAACTGAGTCTAATCAAAAGGTCCCATCTACAATAGG
TAAACAAACACAGGAATGGAATAGGTCTGAGGACATGATCTTCTGGGGTCCACCCAGCTT
CTGTCACATCCTCTTTCTAACTTCCCTCTCATCTTCTTCTTTCTGGATAATTCCAACTCA
TCTTTCAGATCTCAGGTCAATGCTAACTTCCCTGGACTGCCAGAGTAAAGGTAGGTAGGA
CAGTCAACCACAGTAGACCCAAAGTGATTAGGACCACTGTTTGCTAAGCATAAAGCTCAT
CCCCAAGCACAGTCTATTTACCAGTTGAACAGTATAGCTGTGGACTCATTAAGCTGCTCT
TTTCAGACTTGTTCTTTTGAAAGAAGTGTGTGTGCATGAGTGTGTGTGTGTGAGAGAGAG
AGAGAGAGAGAGAAAAGAGAGAAAGGAAAGAGAGAGTCTTAGATTTTTCCATTTTTCTTG
GGACTTGGAAAGTGGTCATTTTGGTAAATCAGTTGAATAGAAAGAGTGGTAATTATTTTA
GTACTGTAGAACCCCTAGAACAGTAAAATAATAGCTAATATTAACTGCCCAAGTATTTGA
AGCAGTAGAACAGAGTGATAAAATTTTTATACTCAGAAGCCAAATCTCATCTCTGCCACT
TTGGAACTGTGTGACTTTGGGGAAGTTCCTTAACTTCAGTGCCCCTGATTCTTCATCTGT
TAATGGCACTAGTAGTAGAGCACACTTTAAAGGTATTGTGATGGTCATTACTAAGGCTTT
TAGAATGCAGTTTCTGATTTGCTGTGGAGTTGACCATAAAAAAAAAACTCCCCACCGTGC
TTTCTTTTTGCTACCTTGCTAGCATTCAGCCTATTGGGAACATTCTTTATCCTTGTTTTA
TTTCAATACATTGCTTGTATCAGCACTGATCAATAGAAATAATGGAAACTACATGTTATT
TTCTAATGTAATTAACTCATGCTGTCTTTGAAATCTGCAAAAGGCTGATAGCATAAGACA
AGGCTACATACAAATGTGCTCTACATGGATAATCCAAATAATCGAGGTTATTAACCAGTG
TTACGTAGTAGAGTTTACAGAAGGAAGCTGGCTCCAGAACCCATTCCTGGATATAACTTT
TATACTCTTGTTATTGTGTAGGGCTGACTGGAAAGAGTTGTGGATTCTTTTAAGAGGCTA
TCTTGAAGATAAATCTTGTTTCAAGCTTCAGAGGAACTAAGTTGGTTTTGATAATTAAGC
AGTGGAATGACCACATGTTGAATTCTGTAAATAAAAATTAACTTAATTTGCCACACATAA
TAAAAATACTTTTTACACTGTAGAAAATAAAATAAAATAAAGGTGTTATGAGAATAAATG
AGTAATATAAAATCTTATATTAATCTAAATCTTAATTTTACCCTATTTTTTTAGGGTGAG
TTAATTGGGACTTAGAGAGTTTAAATGGTTTTTCCTAAAGCCATCCAACAAATCACGATC
TAGGGCTGATTATTGCTACATGGTCTGTCTATTATGGTGGTAAGGAAGACCCAGGTAAGG
AGTAAATCATCTCTACTAAGACCTCCCCTTAACATAAAAGTTAGAGAACTCAGAGACAGT
AACAATAAAGTACCATTGAGACAATGATTGTGGAGAGGGAAATCTGAGGAAAGGAAGGTT
AGTGGAAAAGTACCTGCAGTGTCTGAATGTTGGTGTTCCCCCAAGCTGAAGGGAAGTGAG
TAGTGAATATTCCTACATTTGGACACACTCTGCTTCTAGTTCCTATGAAGTTTTTAGATG
CCCTGTTTTTGAATTCCTAAAGAACCCTATTTAGACTAGGATGCCAAAATTTTTCCTAAA
CTTTCCTCCTGGAATTATGCTTCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved