Dasypus_novemcinctus Locus Mono:248:SNORA63
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:248:SNORA63
Dasypus_novemcinctus
Mono:248:SNORA63
scaffold_129798
SNORA63
1001..1132
2132
TTGTATGCAAGGCTGGTTCAACATGGGAAAATCAATACACCACATTAACCAAATTGAAG
GAAAAAATAACACATGATCATCTCAATCAATGCGGAAAAGTCATTCAACAGAATCTAGCA
TCCTTTTTTTTGATTAATAAACACTTCAAAAGATAGGAATAGAAGGAAAATTCCTCAATC
TGGTAAAAGGCATAGATGAAAAACCCGCAGCCAACATCATACTCTATTGGGAAAGGGTGA
AAGATTTCCCTCTAAGATCAAGGACAAGGCAAGGATGCCCACTGTCCCCACTGTTAATAT
TTACTAGAAGGTTCTGCTTAGGGCGATTAGACAGAGAAAAAAATTAAAGGGCATCCAAAT
GGAAAAGAAAGAGTAAAACTCTCACCTGTTTGCGAGAGAGACATGATTGTGTACTTGAGA
AAATTGGGAAGGTTATCCATGACAAAGCTTACTGTGAGCTCCATAACAAGTTCGAGCAAA
GTGGGCGAGGATACAAAGACCAAACATGCCAAAAATCAATAACGTTTTTGTGTATACTAG
GTTACTGACACAATCTGAGGATATGCGGGAAAAATCTCATTTTCCAATAGCAACAAAAAA
AGACTCAGGGGAAGCGGACTGGGCCCAGTGATTAGGGTGTCTGCTTACCACATGGAGGTC
CGCGGTTCAACCCTGGGCCTTCCTTGACTTGTGTGGAGCGGGCCCACACGCAGTGCTGAA
TGTGTGCAAGAAGTGCACTGCCATGCAGGGGTGTCCCCAATGTAGGGGAGCCCCATGCGC
AAGGCGTGCGCCCGTAAAGAAAAGCGCCCCAGCGTAAAAGTTCAGCTGGGCCATGCCACC
GCACACCCGGAGCTGACGCAGCAAGATGACGCAACAAAAAGAAACAGTTTCCCGTGCCGC
TGACAACAGAAGCGGACAAAGAAGACACACCAAACGGGGGGGGGGGGGGGGGGGATAAAT
AAATAAATAAATCTCTGAAAAAAAAAGAAGTGGGGGGGTAAAAGCAGGGATTAGACTACA
ATACATCTGTTCAGTGCTGTGTTGTCATTCCCCCTGCTAATAATAAAGTTGTTTCTTATC
TATCCCTGTCTGCTGAACTCTTGTAGCAGCCAAGGATGCTTGGTCTCATAAACGTTGATG
GAAAAAGAAAAAGTGAAAAAACAAAAGGCAATTGTAGAACTGGAAAATATAACAAATGAA
ATTAAAAACTCAATGGATGGGCTTAACAGAGATTAAACAATTGAAAAAGAAGACAGATCA
GAACTAACTATTAAAAATTCCATAAAGACAAAAAGATGGAAAGTACAGGAATCAGGGTAA
AACACAAAGAATTTATGACATATATTTTATTATAGTTCAAAGAAATGAGGTAAAGGCAAT
ATTTTAATAGATCATGACCAAGTTTGAATTACAGCAAGAATGCCAGGTTGGGTTTAATAT
TATAAGATCAATTAATATAAACTAACACATTGACAGGTAAAGGGAGAAAAGCACACCATT
TATCTCAATAAATGGCAAAACAGTGTTTGATGAAACTCCTCATCAATTCATGATTAAAAT
TCTCAGCAAACTAGGGATAAAAGTGAATTTCTTAATCTTATGAAGAGCACTACCAAAACC
TACAGCTAATAAAAATTAAAACAATGACTAAATATTTTAAAACTTTTCTTTTGAAACTTG
GAGTGAGACAAAGATGGCTGTCGTCACCACTTCTGTTCAGCTCGGTCCTCAAGACCTTAA
CCCTGCAATGGACAAGAAAGTAAATAAAAATTGTTAGCATTGGAAAAAAAGAAACAAGAC
TTATTATTCATTGATGATATGAGGGTTTATGTAGGAAATTCAGAAGACTCTATAGACTAA
TATATTCAAATTAGTAACAGAATTTAGATAGGTTGCTGGATATAAAATCAATATACAAAA
ATAAATTATATTGCTATATATCAGCCATAAATGAAACAACAGTAAGGAAAAGTATTTATG
TTGGCATAAATTATCAAGTGTCTAGTAATAACTCTAACAAACTATGTAAAAAAGCATATA
TACAGGGCAGTGGTTGTGGCTCAATCAGTTGGGCTCCCATCTACCATATGGGAGGCCCAG
GGTTTGTGTCCCAGGGCCTCCATGAGAAGGGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved