Dasypus_novemcinctus Locus Mono:428:SNORA26
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:428:SNORA26
Dasypus_novemcinctus
Mono:428:SNORA26
GeneScaffold_489
SNORA26
1001..1095
2095
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAGAATGTAATATAAACATAGT
CCAACTTAAAACTTAAAAACCGAAATCCTAAGGCCAAGTTTTTTGAAACCTTGATCATAA
CCATTATGGAGTTATTCAAATAGAAAGACTAGCAAAAGCTTAAGAATTTAAAAGTTAGAC
AGGGGGTACATTCAATTGAGTTCATATTCCAAACAAGGATAATACAAAGAAATAAAAAAG
GCGTTTCTTTCTTTGCAGAATATTCTCCTTTTGCCCCTCCAGATTCAGTCTCCACACTTC
TCTAACTGTGCTATGTTCCAAGAGGTTAATCTATCTGGACTGCATCAACTCTCTTGTCTT
CTGACTTCTGGCTGAGTTTGGTTAATGAAAGGTGGAAGAACAGAGGGTAGAAGAGTAAAA
TTGAAACACTTATCTCCTTGGCTTCATCTCTGCCAGGTCACAGGCTGGCAGAGGCTGTGT
TCCTGCTCCTGTGAGGCACTTCTGCTCTTTTATCTTCAACTCTTGTTGGTATCCAGAAAC
AGTGTCACTCACGTTGTCCCATCAGGCCTAGGGTGATAACAGCTTTCTACTGTTGCTCTT
CCAGGATTACTTCCCAATTCTGTTTTAATTTCCCTTAACTCTATCACACTTTTTAAAATA
GTCCTTTCATTGAATACAGTGACAATATTTGGAAAGTAATTTGTCAAGATAGTCTATGAT
GAAACATAAACATAACTTCATGAAAACACTGAGTTTCAGCAATTAAATATAATACACACC
CTAGACGGAAAACACCATATTACCAATAAAGAGAAATGAAGAATAGCATAGCAAATAAAA
ATATAAACTTAAGAGAGAAGAAGAAAAATATACAGATGATTTTATAAAAATTTTATGCTA
AATTCCTAAATATAAATTGATTGACTATTCTTAGTTCTTTCTACTAGTTTGCAGGAACTA
GTATAAAAAGCACCAGGAAAGAGATAAATTTTAAAACATCTGTGTTCTTCTAACACAGAA
GGGTAAAGTAAGTCTCCATAAAAATGAGAGAGGAGATTACAAAACTCCTCTTTAGATCCC
ATCTGGAGTTACGGCTGAGAAGAAAATAAATAATTAAATAGTTCATAAATATGAGGGTCT
ATTTCTGAACTCTCAATTTGAAAAAAAAGTTTGACAATTATGATTGCTGAAATACCACAT
AAACACTTTTTTTCAACTTCTCCAGTATATTAAAAATACCCAAAAGTTAATACCTGAAAT
CCCAAAAACTCCCTAAAATGACTTTAACTTTATGTTATCTCAAAACTAGGCTCCCCCTTG
CGTGCACCTATTGCGCTGGTAATTTAGAGGTATCTTACCTTTGTTCATGGCCTCCCATAT
GGTAGATGGATGCCCTAACCACTGGGCCAAGTCTGCCGCCCATTTTTGTATTTTGTTTTT
ATAATGTTTTTTTTTTCTCTCCCATCTATATCAGTAATGGGTATTAACTGTAAAATTTGG
AATATACAGATGAGAAAAAGAAAAAAGGAGAAAATAAAGCTCATCTAATCACTATGAGAT
AGCTACTTGTTGGTACCTTTTATCTTATTCTTCCCAAGCTTATTTATTTGTGTGTATATA
CTCAAAATATAGACTTATTATCTCATTGTATATACTATTTAATGCAACGAAAATCTTTTT
GCATGTCTCCTGTGTGCCAGACATTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved