Dasypus_novemcinctus Locus Mono:219:SNORD37
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:219:SNORD37
Dasypus_novemcinctus
Mono:219:SNORD37
scaffold_105851
SNORD37
1001..1065
1639
GGCTCTAAGACCTTAACAAACCATTCACATTTAGAGAAATCTGGGGGAAGCGGATGTGG
CTCAACTGATAGAGCGTCCGTCTACCATATGGAGGGTCCAGGGTTCGATCCCCAGGGCCT
CCTGACCCATGTGGTGAGCTGGCCCACGCGCAGTGCTGCCATGTGTAAGGAGTGCTGTGC
CACACAGGGTGCCCCCACGTAGGGGTGCCCCACACACAAGGAGTGCACCCCACAAGGAGA
GCCACCCCATGTGGAAAAAAGTGCAACCTACCCAGGACTGGCACCCCACACGGAGAGCTG
ACGCAGCAAGATGACGCAACAAAAAAGAGACGCAGTTTCCCAGTGCCGCCTGACAATGCA
AGCGGACGCAGAAGAACACACAGCAAATGGACACAGAGTAGACAACAGGGGGAAGGGGAG
AGAAACAAATGAATGAATCAATTTAAAAAATAAAGAGGTTTGGCCTGCTGTTCACTGCCG
GCAGCCACGGTGTTTCTCCTCAGCTTCGTGGGGCATGTAGCATGGCCGTGAGTTTGGAGG
GGCAGGCAGCTCTGGAGGCAGTAGAAGGGCCAAATGGAAACTCTTACAGAAGCTGAAAGA
TGCTAAAGCGTTTAAAAACATGTTGGACAGACCAAAAAAAGACGGCAGCAACAGGTCCTG
TGACTCCAGCAATCTGCCTGCCAGTCCCCACCGCCACCGCCGATCCCGTATGTCCCACCC
AAGGATTCCCAGAGCTCCAGGAGTAAGATTTCATGACGTCCCTCCCGTGGTGACAGCCAT
GCCACCTTGAGGGCTGTACAATTTCTCTGTAATAAATTCCTGTAATATTCTCCTTCCCCT
TCTGCCTCTCCTTTTCCCATGACATATAAAAAAAGCAGCGATAACATTTATTACACTGCA
TGTTCTGATGTATTTCCAAACATACTTACATTATAAAATAAAAATATACACTTGAAATGA
TAAAAATAAATAAATAAATAAAAACTTTTAAAAAGAGATTTGTAGGTGATGATTGAAATT
TCTTCACTTTGACCTGATGTCTCCTGAAGAAACCCAGTGTCTGATGCTGGCAAAAATAGA
CAGACAGACAGACAGACAGACAGATAGATAGATAGATAAGATTTAATCTGTCATCAAAAA
TCTCCCAACAAAGAAAAATCCAGGACCAGATGGCTTCAAGGTTAATTCTTCCAAACATTT
CAAAAAGAATAAACACCAATTCTGTTTAAACTCTTCCAAAAAATTGAAGAGGAGGGAAAA
TTACCTAACACTTTTTATGAAGCTGTATTAGTCAGGGTTCTCTAGGGAAACAGAATCAAC
AAGAGGTATCTGTAAACAGTCGAGGTTTATGAGATTCTCTCACGTGACTGTGGGGATGCA
CAAGTCCAGGTTCCGCAGGGAGGCTGCAAACCAGGGGCTGTGATGAAAGTCCAATGAGGG
TCCTTGATGCGTTTCCGGGAGACGCTGGCAGTCCACAGACGAGCTGGGAAATTTTGTCTG
AATGCCGAAATCACTTCCCTCTTTAAGGCATTCAACCGATTGGATAAAGCGTCTCATTGC
TGATGGCAATCTCCCTGGTTGATGCAGATGTAATCAGCCATCTGCGCAGTAAACTCACTG
ATGACTAAAGCCCATAAATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved