Dasypus_novemcinctus Locus Poly:1:SNORD113
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Poly:1:SNORD113
Dasypus_novemcinctus
Poly:1:SNORD113
scaffold_12458
SNORD113, SNORD113, SNORD113, SNORD113
1001..1075, 2406..2483, 5967..6043, 8366..8440
9440
TGATGTAAGTAAATAGCAAAATATGTGCAGCAGTGTAGACCTCAGATATGTAAATGTGC
TGGCTTGGTTTAGGTTTCCTACTTCTGTATGAATAAAGTCCATTAAAGAGCAGCCTGTAA
GGCTAGGATGTTCACATATGCAGATATTTGTTAGTCGTAGGTCTTGTTCTTATCTTGGAT
GGTTGATTCCACAGTGGTTGTTACATAATTTAACATTAAAAATAAAATATTGGGTTAATT
AAAAAAATCTCCTTCTCAGACCAGAGTTTATTACCGAGTTCTATATAACTAATGTCCATT
CAAAACATCTCAGTCTAGGCTAAGCCTCCCTTTTCCTCCACAGAATTCTCGCAGGACAGC
CGATCAATTCATTTTCTAAGAAAGAAAATCTGGGCAGCCAGCTCCGTGGTAAAGAACAAA
GAGGCAAATGTAAGTAAGACCCAAGTTCAGGTCCTTGTTTGGGATGCTTTGTTCAGTGAA
GTATTCCAGAGAGGAATAAATGTCTATATACATAAAAGAAGTGAAAAAAATAAAAACGAA
AACGAAAAACAAAAAAGCATTTACCAGTGATGGGAATGTGTTGTGAATCAAAAATTATGT
TTAATTTGGCACAGCTGACTTGATTTTAGAAAGGTAGAAGGCCTTTCATTCCTTTTCAGA
ATTGTGTAAGATCATATTTTCTTTTCCACTGCAAATGACTGAAACATTCCCATGTTGGTT
TGGTCCCGGCTGATAACTGTAAGAACGTGGAAGACACTGCAAGGGTCTCAGAGGCGATGG
GAGGTGGCAGTTTCATCACTTCTTGAACCATCTTCATACTAGGGCCGGTTAAGAGAAAGA
GGGCCATGCCGGCTTGGGTCTTGTGGGAAGCACGGGTGTTATTTGATCCTCTCGTGGTCT
CTAAGGACCATTGCTAATGGGGACCTTGTCTGTTAGCTCTGGGTGGGAAGAGGCTCTAAT
GGGAAAATCTCATTCCTGAAATTCTGTGATTGTTACTCACATGGATCAATGATGAGTACC
ATGGGGTATCTGAAATCAGTATTCTGATTACACCCATCTGTAACTCTGAGGTCCGTTCCA
AAGAGACAGGCAGTTTTTCCCTCCGTGGGAAATGAGCCTGCAGTATCATCTCCTTGGCTT
TTGTGGTTCTTGGAGATGGATTGTATTTTTTATAAAATCAGCCTATTAATAAAGAAAGGT
ATCAATGAATCAAAAAACAAGAGGTCAAGTCGTGCACCTGCTTTTAAGAAATGTGAAGCT
GGCATTAGTTTAGCCACTTTCCGTTTTCTTTGAGAATACTGAGGATGTGGCATGGGCCTT
CCCTGAATAATAAACCAAGCCACTAATTGAGTGAATTCATAAATCCATACCCTGGGTGAT
TGCTGAGATTGTGTCTTGAACCAGAGAAGAAATATCTCCAAACTTTCCTATAGGAAGTCC
AATAAAAGATGGTCTTGCCTTTCCCCATGGGTGTGGGTTGAAAGTAAAGTCAGATAGCTC
CAGTTTTTCCTATTTTTTCATTGCATGGTGGATTCAGTGATACTCATATTTAATAGTGAA
ATTTAAATAAGTGAATAAATAACGAATGATGTTGTTGATAAAATGATGAATAGATTATGA
TTGATCTTCATCCTGACAAACGTGACTTGAAATAAAAAACTAACTCTGCTTTAATTATTT
TTTTCAAATATGCTTTTTTACCGACGGAATGAAAACCAACAGTTGATTCCATCATGCTCC
GGTCGTGCCGACCTTGGCCGTTAACGTCATAAAGCTCAGAGACTCAGGTAAGCATCAGAG
CTGACTTTCTGCTCTGGGGTGGGTGATCAGGCATAGGAGCCCACCAGATTCCCTCGATGA
AATGGTTCAACAACATGGAAAATTGGGGAGTGCCAGCTGTGACCCATGCCTGGAATATGC
CATGAACTGAGCAATGTAGTTCATCCAACTTCGCACAGGCAAGGATCATTATTACTTGAA
GACGTGAGGGCAGTTCACATATTCAGAGCTGTGTATCTTTCCATGCAGTGTTTTGCCTCA
AATGCTTAATCCATCACCTCATTGACAAAAATCTAAGTTGCATCTCTTCAAGTTGGAAAC
TCATGTTCCAACTCTCGGAAGATAGCAGACATTAGTTTCCTCAGTCGCGGGCTAGAATGA
AAGGCCCGTGGTGTTGGTTACACCACTTTAATGTACAGACCAAGTAAATGAAACGGGCAC
AAGTACGGGATCGATAGGAAGCAGGGGTGCTGATTAATCCAGATGCGAATCAGAGGCTCA
TTGTGAGAAGAGACAGATCTCTTATCCTTGGTTTTGTAATTAAAGCTTATTGATTATATT
ATTCTTGAGTCATGAGTGAATTAATCTGTTAAATAAGGTATGAATGAAGAACTAGACAGC
CAAGCCTGGATCAGTGGTGAGTTCTGGTGGAGGTGTGTGAATCAGCATCTTTGATTAAGC
CCTCTGTGTCCTTCTGAGCTCCATTCGAAATAGAGCATCAGTTTATATTCTCTGTAGAAA
TTAGGAAGTGCCCCTGGGCAAGCACATAGGGATAGCAGCACACAAAGGGGATTTCAGGTC
TGGCTTGTATTTTTCCAGGTATGTGAATAGTTGATTAAATAGTATATGAGTATTTAAATT
AATCTATAAATGTTTGCATTGATACAGTAGAGTTGTTCTTGAACTGGGATGAGACTATGC
CATGAAATAATTTAAATTTATCGAATTCTTTTTGAGTAAGGGTCATTATGAAGGCCTTAG
GTACAAGGAATATGGAGGCAGATATCTTTAATCATTACAGATCTTAAATTTTGTGCTAAA
GCCTAGACTTGATAATGTTCATTATATTACTTAAAATTAAACCTTCTGTATGAGATTAAT
AAGTAATAAAAAGAAGAGTGTGTTCTTGGACCGAGGTTTATTGTTATCTAGTTCTGCCTC
ACTGGGATCCATCAAAAAGTGAAAGTCAGCCTACATTTGCTCTTTGCTTCCCATAGGAAT
GGAACATAGGACAGCCAATCTATTAATAATAATTTTCTCAAAAGGAATGCTGCCATCAGA
AAGGAGCACCGAGACTTAGTAAGTCCCTTAGTTTGTGTTCTTTGTTTGGATGTTTTTTCC
CGTGGGTGTTTGCTGAACTATTTCAAAATAATACATGTCTTCCTATGTAAAATAAACAAC
CCCAAGTATAGAGAACAAAAATTACCCTTACTCTACACAAGCACAACCGAGAAGATAGAA
GTTATTTATTTTCAGAGCAGTTTAATATTCTTTTTTATTTTCTAACCAATTGATTGAAGT
ATTCCCTTATGGGTAGAGACATTGCCTGATAACTCTTTGGGGGTCAGCCCCTAAGGACGT
GGAAAACAATTGTGTTTTAGATGTGGTAGAGGAGATGGGGGCTGCAAAGCTTTTTTTTTG
AACCATCCTTAACTCATGATGCATTAAAAGAGGACCACACAGGAAACAATGCTGAATGTG
GATGTGATATGAGGCAGGGGTGCTGGCTGACCCATAGGTGCAATTTTGTAGGCGATTGCA
AAAGAAATGTAAACTATTAGCTCTATGGGACAAAAGCCTAAAATTTAAGGATCTTGTTTT
TGGAATTTTGTGATTGTATTATTATTTGTGAATTGGTAAAGTAGTCAGTGAATGGGAAAA
ACACCAACCATGCTTACTGGCATGGACCAGTGATAAGTGTCATGGTTTTTTTTTTTTTAA
TTTATATTTTCCATATTTTTTTCTTTTTAAACAAGTCAGTTTTATTGATACATATTAATA
AGGCATACACTCCATCCAAAGTGTACAGTCAGTGGTATTTCATATAATCACATAGTTGTA
CGTGTACATACAATGATTGAAAGAACTTCAGTCATTGTTAGAGCATTTTCATTATTCCAA
TAATAATAATAATAATAATAATAAAAACAGACAAACCAATAACAATAAAAAATTCATCAC
CTCTCAGTCTCTCTGTGCTTGCCCTACTGTGCATAGCTGCCATTTCTGGCTATTCTTGCT
TATTTATTTATTTATTTTAAAGCAGTTTTTTTTTTTAAAAGATATATTCACATGCCATAC
GTGGGGTTTCTGAAACAAGGATTTTGAATAAACTCATCTGTAACTCTGAGGTCCTTAACA
AAGAGAAATCTAGTTATTCTCTTTGTGGGGAAATGAGATTCCTACGCCTTGGTCTCGGGC
TTTTGTGATTTATGGGTGAGAAAAGCAGACCTTGAGTAAAGTGATGTGTCAATGAATGAA
GAACACACTTATTCTCAAGGGATGTAATGAGACGTGACATACTGTTAAAAGAATTCTGAG
ATTCATAGTCACGGTGAATTAATAAGCGAGGCTCTTAGCACCCTGAGAATTAGCTTATGG
TCGTTTGAGCATAAGAATCACTGTTTGCGATCTATGTTGCTGATAGATCTTTTATTAAGG
ACTGGTAAACATATTTACATAAATAAACAGTTGATTGAATAGCTACGTACCTGAGAGAGG
CAAGCATGGATCGATGATGAGTCTTTCAGTCAAAGATGAATGCAATCTTTTAAAATGGAA
TTTTATGAGCATACAAACCTAAAAGGAGGCAGTTTGCTCTTTTGGGTAATCGCATCGGGA
CAAATGTTAAATATTATTCCTTCTCTGATACTGCACAGATACTGAAGTAGAATTAGAAGT
GAAGAGCATACATTTATAGTTCAGTTAGTTTTCTTTTAAGTTGCGAAATAATGCACCAAT
GAGAAGCGTGCCATGGATATAATTGTCCCTCATACAACTTGTGTCCACAGGAAGACAAAG
AATGTGCCATAGACCTTTCTAGTTGTGCTAGAGACATCTATGAGTAATAATATTTCAATT
GTTTTGCTGGTTGTTTAACCATCAACTTTTGAATTTCTTTTAGAAAAATGAAGGGATGGT
CTTGTTACTATAGGATAAATAAATTAATTAGTGATACGACAAATTAATAAATGGATTGAG
TCATGCTTTGGCCATTGGTGAGATTGTGTCATGAACTGAATCTCTCAGGTATCTAGTTCT
TTACAAAGTTCAGTAAAAAGGATGCCTGGGGCTTGTACCTCTGTGGGTGGCACATATAGA
CAGATTTTCCTAATAAGAGTTCTTTTTCTTATGTTCACTGCTGGATTTAAGGTGTTCATT
ACATTATTTACAGCAGAAAATTACTTGTCAATAAATTTAAAGTAGTTTTCTCTCTTCTCA
AATGTTGGCAATATGACATAAACCAAGGTTTATGGTTAAGTTGATTATTGCATGGCTATG
TTTCATTTAAACAAGCTAAATGTAGACTGATTTTTTAAAATTTGCTTTTTATTCCTTAGA
ATGCACCCATCATCATCATCATCATCTCACGATGAAGATATTGACTGTTACGTCTGTGGG
GAGGGACAGACCAGATCCATGCAAGGTAGAATAAAAATTCATGCTCTTGCTTGGGGGTTT
TGCTCATGGGTATTCAGTGAATTATATAAATACAATGAATGCCTACATATGTAAGCAATT
CAAAGGTGGCTGTATCTTGACCAATGAGTGGCTTCTCCACGATACTGTTATAGACTGGGA
ACCCATTGAGGTGGGAGATCCAAAGAAAATGGAAAGCCTTGCCTTTGCCTGAGCTGTGCA
TAAGATGACCATCTCTTGGTTGTCCATTGTACTGTATTTAACATATGGGCTACTTTAGCA
GAAGAGGCCTGAGCATAGACAGTGACAAATATGAATTTACGATATGAAAGGAAATTGATG
CATTTATACCTACAGGGCTGAAGTGCACTACACAGAGCTCTAGTTTTCTTTCTCCATGGG
AGTGGACTTTTATAGAGCTCTTCATGCCTTCAAGGATCTTTTTTCCCCCTTCTTCTCTAA
TTCATTGCTATTGATTCTATTATAATTAGTGAATCAGTGATTAAATCAAGAGCAGTATAA
TTGAATGAAGGCGTAGAAGGCCAAGTCTGGATCAATGATGAATACTTGTAGGGCATCTGA
ATAAAAGACTTTGATTAAACCCTGCCTGTAACTCTTATGTCCATTGCAAAAGTGATATAG
CGATTGCACATACGGGAAATACGGGTAGAGAGGAAATTAGAAGTATTTAAAGATCATGTT
CTCAGACACTTATTGCTTGTGGTAATAGATTGTTTATAAATTAATGAATGCATGAATAAA
TAATGTATAAATAAGCAGGAACAAAGAGGGCTATACCTCATCCAATTATGAGAGAAGCTA
ACGAGTCAAGGATTATTGCCAATGCATTTCTGAAGTCTTGAGTTCAAATAAAATAATTGA
TTAAGGCTTCTTCCCCTTTGGGGAAGGAATAGATAGATATAGACACCTGGGTATGAGCAT
TGTTGTGGGATAAAACTCTTACATAATTAAATAATGTATTTAATATCATAATATTCAATA
TAATCAATAATAATCCATATGATAACTATCTGTACTCAACAATAGTTTAATATAAGAAAT
GACTACAGTAAACAGATTAATGTAACTTATTACAATAACAATTTAATATAATTAATACAT
AAAATACTAACATTAGGTAATTAATTAGAAACTTTGAAAATGTCTTTGTGTAAATGAACA
TTGAGGATGTTAATTTAATCTTGATTAAGCCTCTTGTGCTGACATTGGTTTTTATTTCAG
AAGAAAAATGTAAATGAACTTTGATGATTTCTGTGAGTAAATAAATGAATGGGTAGATTT
TAGTGTCATCCAAGTTTCTCGTCCAGGGTCTGTGGGCTTCAGGAGAGTGAGGGAAAGAGT
AATCTCGTATTTTCAACCCATTATTTCAGAGATGGCAAACCCTGGGCACAGGGCCTGGTT
GATCACTGCTTTAGCCTCTTGAAGGGCATTTACAGGAAAAGACCCAGGGGGAGACCCCTT
CAGGGAAGGGTCATCCAGCCCCGCTTTCTTGCTCCATCTAGCTATTAGCATTTAACTTAA
AATTAGTGAAAACTAAAATTTCAGTTCTGCAGGTGCACTAGCCAAGTTTTGAGTGGGCCA
CTTGTAGCCAGTGCCTGCAGTGTTGGGCAGAGCTGACGAAGAATGTTTCCATTATCACAG
AACTTTTGTCATCACACATGGTGCTGATATAGACAGTAGCCGGTAATAGTTCTTAGTTCT
GCGTAGCAGGTGGCTTTACCATTTTGTGTTCCTTGAGAGAAAAAAATGGATAATTAAATT
ATTTTAATGGGCCATTAGATAAATGAGTGAATAGTTTATAATTAATTCATTTAAATAAAA
AAATAAATGAATCAATCATATTATTATCAATCAATAAATACATGAAGTAAAGTTGAGGGT
GGCCCGCTTGTTCAGATAGTGTCAGGAAACAAGGATTAAGATTCATCCCATTTTTGCATT
AAAGAATTATCTGGCCTTCTTGCTATTTGGTAAGCTTATATAAACAGACATTAGTGATAA
GTTATATATAGTGCTTCTTGTGTGGGGTGGTAGATAAAAAGGTGTTCATTTTAATATTTT
GTACTAGAATTTGAATACGTCAGTACACAAACAGGATGCCCGTGATGCGAATGTGATACA
AACCAATGTTGCTGGGTAATCTAGTAATGCAGAGCTCACTTTCAACAGTGTGGCTTTACA
CTGTTGATTCTTTTAAAAATCTGTCTTTTTCTCCAGCAGGAACATGCTGCAGGACTGGTG
AAGACTGTGGCTGTCACCTGTGAGACGAAGGAGCGCAGAGACCAACGTACGTAATAACTC
AGAATTCCTGTTCCTTGGTGTGTGAGTGGCCATGGAATATTTCAGTGGAGTGAAAGCCTC
CTTTGTGCTCAAATAAAATCTAAGGACATCAAGGAGGGCTCATAACGGGGGTGTGCTATG
GGGCCAGGAAGTAGGATTAATTCACACCAGCACAATTGAGATCCCAACTTTAAGGTGAGG
GACATCTGACCTGTTTTCAGAACATTTTGATGTTCTGTCTTCTTCTGAACTGCTACAGAG
TTAAATATTTCCCTGTCGGTGGAGATTCAGACTAGTCACTATTTTTAGGGGAAGCTCTTG
GAAGATGGTACAGATTGTTTGTGTTCTGGCTGTGTTCTCTCATGAGGTTTTTGGTAGGTA
TTGTACTATGCTTGAAACTGGACAGATGAAATGGACGTAGTGCAGTCATGGACCGTAGAT
ACCGATGGCACTTGATAGGAAGCCAGGGTCATTGATTGCTCCATATAGGCCACATTGAAA
GCTGTGTCTGAAAACCCCAAGTCTAAAAGCTTTTTGGAAATGAGCCTAGAGCTGGAACAT
GATCATATGAAGGATTTTGTTCTCGGGAATTTGTGATTGATGGGATAAAGAAGTTATAAA
GAAATGAAGAGAAAGAGTCATAGACTTGGACCAATGATGAGCTTGGAGGGTGTCTGAATC
AAACATTTTGATTAAACCCTGTCTGGAATTCTGAGGTCCATTATAAAAAGAGACCTGCCT
TTTCCCTCTATGGCAATGAGCTCACAGCAGCAGTTGAGACTATTCAGGCATTGGATCATG
TATGTTCTCAATTTATGGATATCGACCAGATCAGTGCATGAATAATAAAGAAATGTGGAA
ATGGATGAATATAAAGAAGGTCAGCCATGGACCAATGATGAGAGTATATAAGGAAAGTTA
AGTTGTGTTGATAAAGGCTGTTAGCCCTTTCTGGAAAGAGCTTTAGAGAGATGTCTACAA
AACTCAATATTATTGTTTGATACAGGTGGTTGGTTGTGATTGTTTTTATTTAGAGAAGGG
AAAACATTTACATAAGTATCTGATTAAATGGTTATTTAATTGGGAAAGAGGATGAGCTTG
GTTGATCTTGAGAATTTGCCATATGAAAGCAGTTATTACTACAGCTCCGTTTACTGAGTT
TTATTAACAAATAGAAATAGCATCTAGTTTTTTTTCTTCCCTGAGGGTAGTGTAATAGAC
ATACAGAAACATGTCGGTGTGATACATGGTTCTTGCCCTTTTGTTGGTTAACTCCCAGCC
ATCGATGAATTGTTACATGTGAATGAATAAATCCTTAATGCAATCAGTTTTTAAAAAAGA
GAGCAAAGCGTGGCCCTATTGAAGCATGCATTTTGAAGTAAGAATAAGGATTAATCTTTG
TCTACATCCCTAATGGGTATAGATATGCAGACATGTGAAGAGAGTTCCCCATCGGTGTAC
CATTATTTTGTGTGTGTGTGTGACATTTTTCAGTATATCGGGGAATATATGATTGAAGTA
TTCCATGAGTCATTTCACAAGTGAATAAATAAAGAATGAATGATTGAATTAATATAGAAG
TAGGGTCAAGCTTGGACCATTGGTGAGATTATGCCATGGATCAGAAATAGAAATTTATCC
ATTTCTACAAAAGATGGGACCATTGAAAACATATCTATCTGGTTTCTAGTCTGTGTGGGT
TGGGGGCTGTAGACAGATGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved