Dasypus_novemcinctus Locus Mono:185:SNORA57
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:185:SNORA57
Dasypus_novemcinctus
Mono:185:SNORA57
scaffold_80089
SNORA57
1001..1149
2149
ATCTCTGAAAAAAAAAGAGAAATATAGAAGGTAGGTAAGTAAGAGTAAGAAGGATAGGG
TCAACTTGTGAAGGTCTTTACAGATAAGCTAACTAGAAAACAGAGCACCAGTGGAAATCT
AAAAGCCTGGACACGAAAAGAGAGATTTGGTCTTTAGGAAGGCAACTTTGGTAACAATGT
TAAGATAGGAGGAGGGAAAGACCTATGGCAGCGTGGCAAAAAAGTCCAGTCAAGATTTTA
TGAATCTGAAAAAGGAATCACAAAACTCAAGTTCTTAGAGACATGGTAGGTAAAAATGTA
TGTAAGATCTGGGAGAATGGTGGTATCTGTAGTCTTTGAAGAGGGCAGGTCCTGCCTAAA
ATTATTCAACCACAAAATCTTAAACCACTGGACTGGTTAAACTAAGTGTCCAATTTTGAG
CCCTGAAATTAAGTCACTGACAGAAAGGTCATACACCAAACAGTACACTAATATAATCAA
CAGGGTTTAGCAGCTATGGATTTAGCAGATTTAGAGGATGTGAGACATAAAATGAATGAA
CAGGTAGATTTAGTGGATATAATTAAGTGTTCAAGCATATAGCAATACAGCCAGATAGCA
GATACTGGGTAGGGGAGATAAGTTCAGTTATAAACATGTTGAATTTAAAATCCAGTTTGA
ACACCCTGATAGATTTGTCAAGTTGGACCAAGTTTGTCAAGGTCTGTCAAGTTGGAAATA
AGGGTCTTAAGTTTGGGAGAAACACCTAGGCTAGGTAAACATACTGAGGGAGGTTGAAGT
TATAAACATATTTGAGATCATTAGAGGAAGGGGGATGGAGGAGGAGTGAAAAGATATCCA
AGGCAAAGCCATGCAACATCTCAATATTTATGGTTAGTCAAAAGAGAATAAGTGACACAG
AAAGAAACTCAGGCTTTTCCCGGGAGGCGTCGGGGTGAGTGTGGGTTTCCATGGTGGCCT
GCGGAGGCTGGCCGCGTGCGCCGAGGCGGGACCTGGTGGACCGTCCTTTTCTTGGCGGGG
ACCGGGCATGCGGTCCCAGACCCCGGTTATGTATGGAGGCAGAGAGAGAGGGTCCGGCCC
CCGTGGCGTCATGTCTTCGGTGCCGGCGGCTTCCCGTCTCCCGGTCCTATCCTCAGTCAC
CGGGACAGGGCTCCAAGGGCAGGGCAGAACCTGGGGTCCAGCTGGCTCCTCCCTGGGGTG
CTTACTGCTTCTCTTTTGATTTCAGGTATCTGGACTATGCCCCGTGGCCGGGAGCAGTCG
TATCCTCCTCCTCTCTTTAATTCCGCTGTAATCAATAAAGGCCGGTTTGTGCTTGTAAAA
AAAAAAAAAAAAGTAAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGATCT
CTAGGCTAAACCAGTTGCCCAGGTTAATTTAGGGTAGAGTGTTCCAGAGAAGGCACGTGT
CCAAAGGCCCAAGGTGAAAGACAGGATGGACCACTGGGGTAACTGTAAGAAGCAACATAG
CTTGAGGGAATGCGACTACTTAGAAAGAAGGCTGAAGAGTTAAAAGGTCTAGTGGTAAGG
AGCAAGGAGACAAGAATAGCCTAAACAGAATTAGGATTGAGGTGGGGAGGGGGTTCTTCA
TAATGTTTAGAAAAGAATATGGGAACAAATTCACTGGTAAGACAGTTATCTACAGTTCAA
TATTCACAATTATTACATAGACAAGCAAATGCGTTTACTGCTCTCTTTCTTTAACAATTG
TTTAATTTGATTACACTGTTTATCTCAAGAAGAAAAAGAACAGACAACAAAATGCAGGAG
CAAAAGATGGACAAAGCTGTAATACTAACTGGTTTGACTTCTCTAAGGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved