Dasypus_novemcinctus Locus Mono:262:SNORA71
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:262:SNORA71
Dasypus_novemcinctus
Mono:262:SNORA71
scaffold_2028
SNORA71
1001..1133
2133
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTCGGTATCAAACCCTGGACCTCCTATA
TGGTAGACAGGAGCCCAATTGTTTGAGCCACATCTGCTTTCCATTTAATATAATCTTGAT
GCTCATATAATGATGTTCTTGTGAGGCAAAAGAATATAGAAGACATGGGGTTTGGAGTTA
AAAGTGGGTTTAAATACTAAATCAGCTCCTTTGTAAAAAGTTTCAGTAACTCAATTCTTT
GTCCAACCCCATCTTGCTTCTTCTTTATCTCATCACTTTGGCAGGTCTCGTGTGGTAGCC
ACTCACAGTATTCATGGCGCTCAGAAGGAAACTGCTCTTGTAACCTGCAAACTGTAGGTA
CAAGAGGAAGCATGTGCTGAGCCTTACAATAGGGTCCCCCAGGTTTGAGAACAGGCACAA
GGTGAGCACAAAGAAAACCAGTTCATCAAAGACTAATTCCCATCTGCCATCGAAAGTGAC
CATGGGCTGCCCGTGTCCTGTTCATGGATATTGCAGGGAGAGGAATGTGGAAAGCAGTTT
CCTGTGTTTGAAGGGTCCACAGCTGTCCCTTTCAAATGACGGCACTTTCATACACTCCTG
CTACTCTCCTGCCAGCCCCTCCCAGCCTTGGGCGCATTGTAGGCCACTGCGTGACAGTGA
CAGGAGATTTCATAGCTTGGTCTTCCTTAGCTTGTCTGTTATCAGAGACCAGGCTGTGTC
TTTATCAATATTTAGATATTTCGAGGGCAACTGAGGATTATAGAGCTTTAACCCTACTTA
CATGATCTAATACCTTTTTTTAAACAAATCAATTTTATTGATACATATTAATAAAGCATA
CAATGCAAAGTGTACAATCAATGGTATTTGCTATAATCACATAGTTGTGCATACAACACT
TGAGTCATTATTAGAGCATCTGTGTGTCTGAGAAAGGTCTATGGGAATTCTGTACTTTAT
GCATGATTTATCTGTAAAAAACTTCTCATAACATAATGAAAGTCTATTAAAAATACAAAA
AATAAAATAAGAAAATTTAAAAAGAAAACAAATCCATGAAAAGTAACTGCTGAATGACCC
ATTTATCTAAATGCCCAACTCACTGAATTGTTCAAATTTACTGATTTATTAAAAACTTGG
TTCTTTTAACTATTTGCAGAGTTTAAAGAAATTTGTATTGGCCAGAACGTTTTTAACAGC
TACTTAAGATTTCTGCAAAATTATAGCTAACCACGTTTCATTTTCTTTTCATAATAGTAT
ATTAAGGAATACTCTTTGCTGGAAGGAAAGAATAACAAGATGGTTTGGTCTCCTTCTGAA
AGCACTGAATATTTCAGGAAATAGATTTCATTGTTAGTGACCAAATTTTTATTGTTTCAT
GAGATACTCTTTCAGTGTAAAGTGATTCCTTTCTCGTGTATTTTTATATAATTTTTTGTC
ATGTTCCAAGTTCAGATCAAGACTTTACCACTTAGTCACTAGGTAACCCTGACCCGGTTG
CTTTATCTCTCTGTGCTTTTTTTCTCTCAAGTGGAAAATGGGGAAAAGAGTAGCTTTTGT
TTCATTCAGCTGTTGGGGAGGATTAATTTAATAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved