Dasypus_novemcinctus Locus Mono:388:SNORA66
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:388:SNORA66
Dasypus_novemcinctus
Mono:388:SNORA66
GeneScaffold_4689
SNORA66
1001..1133
2133
AAAGAGTTAGAACTGTCCTTTGGTGAGTTTTAGAACAAAATTGCCTGGTCACATATCTA
ATCAGATAGCCTTTCACAGTTTTCTAAGAAAATTAGACTGCCTTCTGATATCAGAGGGCT
GTTAGACACTAATATCTGAAGGACCTTCCCAGGTACTGATGGAAAATGTAAATCTGGGGA
ATGTTGGAAGGACAAAAATGAATTTGGCAATTGCTTATTGACGCCAGGGTCAGTGTCTAA
TCCTTAATACTATGTTGTGTTGTGCCACATATTCTTAACATCTTAAATGCTTTGTTTTGC
ATGCATCACCAGTTGAATGAAAGCTTTCTGGTCATACATCTTTTAAGCCAATTTTGATAC
ATATTAGTAAAGCACTAATAATAGGAGCATTAAATTTAGATTTTATAGAAATCAACTTGT
CCTAAACTTGAACAGTTCAAGAATTTATTAGAAGGTGGGAACATTTAGAAATTTAAGTAG
ACACCAATATTAACTTTATTAGTTCCTTTTGAAAATACGGCTTAGGACAAAATTGAGCAA
GTAGTAGAATACATAGCACATTATATATCGTTTAGGACATGTGAAGTGAAACCAAGTACT
GTTTGATTTTTTTTGTTTCAGATGGAGGAGATGTACAAGAAAGCCCATGCTGCTATACGA
GAGAATCCAGTCTATGAGGAAAAGCCTAAAAAAGAAGTTAAAAAGAAGAGGTATGTGTCT
TACTCTGTGTTTTTTTTTTGTTTTTTTTTTTTTAAGGAAGTAGTGTGGATTGACCTTGTA
CATGGGAAGCAGGAGCTCAATCACTGGGCTACATCTGCTCCCCAATGAGAATTGTTTGTT
TGTTTTTAGGAGGTACTGGGGATTGAACCTGGGACCTCGTAAGTGGGAAGTTAGATGCTC
AACCATTTGAGCTACATCCGCTCCCGTCTTATAATTTTGATCTTTGGAGGTGGTTTCTAA
CTGCCTCCTTTTATCTGGTGTGTCAGACTCTCAGTGAAGGTGTGCAAACTCGATCACTAG
CTCTGCATGAAGTTGCAGAAGCAAGGGGAACCAGGTTTGCTAAAGTAATTGTGGTGATAG
AAATGTATTAGCCTCAGGAACTACTGGGGTGGCCCATTCTATCCTAATACAGTGTAACTA
CCAGATTACTGCATTTTAAAATTAATTACCTAAAGAAAATAGTTGGCTTCTGCTGAAATG
TTTGTTTTGTTTTGTTGTTTTGAGGTAGTGGGGCTGGGGGTTGAACTCGGGACCTTGTTT
GTGGGAAGCTGCCACTCACCAACTGAACTACTCTGGTTCCCTTGTTGAAATGTTTTGATC
TTCGAATGGAATAGAGATCATCTAGGCATTACACTCACGTTTTATTCTTGGGCCTGTGTG
GTACTAGCACAGTGTCACAGGAAGTTGGGGGTTGGGAAAGTTAAAGATCATAAATAAGTA
CATGTGTTAGAAACTTGGGTTATTCAACCTCCATCAGATTATAGTCTTTGTCGTTTTCAA
TAGAAATTCAATATTATTTTCTTTAGCTATAATTTTAAAATATTTGTCTTATTTTACTTA
TTTTGTAGGTGGAATCGTCCCAAAATGTCTCTTGCCCAAAAGAAAGATCGGGTAGCTCAG
AAGAAGGCAAGTTTCCTCAGAGCTCAGGAGCGGGCTGCTGAGAGCTAAACCAAACTGAAA
TTTTCTATGAAGATTTTTCATACAAAGACAATAAACTTATCAACTTGCTATTTCTGTGTT
AAGCTCTTGTTGTTATGAAACTAGAAAATACCGTGAAAAAGTTTATCTGCATATTTACTT
GAAACAAAGTTCACATCTACTTCTTGGGCCTCTCTTCTCCCTGACAGGAGTTATGTACAG
TTCTTCCTAAAAAAATCTGGCAAGCAACAGACAACCATCACTAGTAAATAATTCTTCCAT
TCATTTATTGTAACCACGTGAATAATGGGAAGAAAATGTACCTTCAAGTATACAGTCTTA
AAAGTGGTGTTAATTCGTGGCTTCAGTTTTTGAGAAAACAATCCAATGAACAACACAACT
TGAATACACTCACTTTAGCTGGGTGAAAACTTATAGCAGAAAGTAATGAGTCTTTCTTTA
AAAGGTGTTTAATTTTATGGAGATGTTGAAAGAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved