Dasypus_novemcinctus Locus Mono:240:SNORA55
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:240:SNORA55
Dasypus_novemcinctus
Mono:240:SNORA55
scaffold_123691
SNORA55
1001..1135
2135
AGAATCAGTCGATATCAGGTGAGAGATGGTTCTGGTCTAGCTTACTAGAGAATTTACCA
GCTTACAGTGAATTTACTGTGAAAGTTTTTTTTGGTATCTTTATGTTTAGCAGGCTTTCT
CTTTGAGGATCTGTAATGTGCTCTTCCTTTCCCTCTCTTCCAGGAATATCAGGCTTAAAG
TGATATTACTACTAGTTATGGTAGTTGTTAGAGAACAGTGACAAAAGGGACTAATTGGTT
CATTTCACGGGGCTCTGTTCTTGGACCCTCAGTTATTGCTCTTGGTCATACAGGTATAGG
TCCCTTTTACTTGCACAGTACCCATTTATGTGGTATGATGAAGAGATGAACCCTGCTGGG
TGAATGGGAAACAGGGTCAGCCAGAGTAGATGTGGAGGATGATAAACATGATGCATTGAT
GGGGCTATGAGAGTCTTTGAGCATTGGTTCCTCTCTTTGAGCCTGCATCTGAAACATCTG
TAGGTCTTGTTGAATCGTAGATTGCTGGGCCCTAGGCCCAGAGTTTCTGTTTGATTGATT
AGGTTTGGGATCTAGCCTGAGAAGATTTTAGAACCCCACTGTCTTAGGGAATATATGGGA
TAAAGAAGTACAGTTAACAGTGCTCATTCTCCTTCAGGGGGTGAATCTCTACATTAAGAA
CTTGGATGACACCATTGATGATGAAAAGTTAAGAAAAGAATTTTCTCCTTTTGGCTCAAT
CACCAGTGCTAAGGTATTTTAATACTAAGATTTTGAGATTGAAAGCGGATGTAGTATCCG
TTAGCGATTTATTGGCGTTTATTATTTCATTGAAGGAATGGGATCTAAATTGCACTCATT
TCTGAGAGTGTCAACTGCTGCATTCTAACAAATTCCTCTTGTATCAATTACCCATCTGAA
ATGTTCTCTGGGGAATTGTTTCATTAAATTAATTGTATTGTGTTCCAGTCAGTAGGGTAT
GGAGATGAATCTGACCATTCCCTCCCTGCCAATCCCTTAGAGCACCTGAATCTTTCCCAT
TCCCTGCTGCTTTGTGCTGGTGTGGGGACAGATGGTGCTACAGTATGAGCAGAGGAAATC
CAGACAGGTTGTTTTCCATTTGCCTTGAGGCCTGTCTCTACAACTCTGCCACAGTTTCTG
CTTTCTGAGAAGGGAGATTACTTTTGAGGACTTTGGAGCTGGCATTGGGAATTTCTACCC
TGGTCTCATAAGATATAGGTCAAGTGGGGCAGAAAGTTTGCTTTTCCATGTTATGCAATA
TACATCATTTGCTTGATTTTCTTTGACAATTATATCAACTGAGTTTGCAGGTTGAGTAAG
TATAAACCCCATTTTAATGATAAGGGATTTGATTTCCTTGAGCAAGAGAGTGCTGGTTAC
TTGAGCATGGAGAGAAACTGATGGCAACTGAAAGTTTGGGTCATGGCCTAATGCAGACCT
CCTTAGCAAAGGTACGGTAGATGTCATGAAGTCCTTCAGGTGAAAAGAAAGGAGGCCAAA
GTGAGCTGGTAAAAGGCTTGTTGGCCCTGCCCCAGCCCTTTGCTTAAATTGTTCACAGCC
TGGGAGTGTAGTTCAAGGGAAAGTTATCAGTTGGCAGCAGGGTTTCCTCAGTTCCTTGAC
CCTTCCCTCTTATCACCCCTTTCACTGGCTCCTTCGTCACAAGTGAAAGATAGTCTCTAC
TTACTTACCAGCATAGTAATCAAGTTGGCATTTGCAAGAAGAGAGCAGAAGAACCACAGG
AAGTTTCAGAGGCACCGTTTTCAAGAATGTGATGCTGCATTGTTTTCCCCTACCTTATTG
GTCTACGTTACCACTTGGTAGAGTTGTTGGGCTGATACTTCTTTAGTCCATGTTCTCAGT
TTCAGGAGACACCCCAGCCAGTGAGCCAAGATACAAGGTGGTGCCAAGCACATGTATTCA
TAGTGCTACAGAAGTGGTGGGGAGGGAAGTAGCTGTGGCTNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved