Dasypus_novemcinctus Locus Mono:392:SNORA70
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:392:SNORA70
Dasypus_novemcinctus
Mono:392:SNORA70
GeneScaffold_6114
SNORA70
1001..1117
2117
TGCACAGAAGAATCGTGAGTAGAGAACTCCATGCCACGGAGGTCAGTGCCCATGGCACA
CAATACGCCTCACAGTGTAACACTGACTTCAGCTACTGATTAATGGATTTGGCAGGCTGA
AGTAGAATCCTAGGAACAACTAAACTTTGAGCCTGTCCAGGTCAGAGAGAAGCCAGTAGC
TGCCATTTTGACTCTGCCCCAGGCACGAGGGGAAGCAGCGCTGACTGAAAATCATAGCGC
TTGTAAGGACCGGCTTCTTTCCACCCAGGCTGGATTGCAGGTCTAGCCTAAATCCCAGTC
CCACTTCCAGTAGGGAGGAAACTGGGGAAACCTGTACCACCTCTCTGGGAAGCTGGATGC
CACACTGCAGAGGCTGGTGCCATCCTACTTTAGGGGAGTAAGCTGCCTCAGGAGAGATTC
CATGGCTGGAGTTGGAAGCTCCATTTCCCATAAACGGTGGAGGAAGAGACAGTTGTACAT
TGACCTCAGCTAATGATTAGTGGACTCAGCTAGCCAAAGTATAATCTTAGAGACAGCTGG
GCTCTGAGCATGTCCAAGCAGGAAAGAGTTCCGTAGCTGCCATTTTGACTCCCCCCCGGA
CACGAGGGGGAGCCTGGCTGGCTGAAATCCAGTGAAGTTAGGGATGGGCTTCTTTCCACC
AATATCGGACTGCAGCCCTAGCCTAGGCTCCAGCCCCTCCTCCAGCAGAGAGGTATCTGG
TGGGACCTGCACAAGGCTCTCCAGGCAACTGCAAGTGCTCTCCACTGGCACAGGCTGAAT
AGTCGGACACCTGGGGCTGCATCCCCACACCCCAAAAGAAAAGGAGAGGAGCTGTTATCC
TCAGCCTTTCCGGGCAATGGAAGGAGATTTCAGCCCATACAAACAGGTTTGTTGAGTGCC
TATGAGCCCATCTCCACATACGTCCCACCACAGGATAGGAGGGGGCTGGTTTTGCCTCAA
CCTCTCAGGGCAACTTAAGAGTTGGGAGTGTTCAGCCTAAACTGCAACACATCTCCCCAT
GGGGGCCTGGTGTGCAGTGGCTGCAGACAGCAGCCTCCTTGGTAGTGTATGTGGCCTGTT
TCCTGTACAGGTTGCCCTAAAGGACCTTGAAGACTGCCCTTCCTTGCCTATTGTGGTTTT
GGGTTGCATAAGCCTGACTGTTGGGCACCTATGGCGCCACCTCCATCCCCAATAAGACAA
GAGACAGACTGTGTTTGCCCAGCCTCTCAGGGTAACTGCAGGTAAGTTTGGCCCACACAG
CCTGGTATAGTGAGTACTTGTGGACCCACCCTCACCTCCCAATAGGAAAGAAGGAGGCTG
GTCTTTCCACAGCCTTTCTGGGCAATTACAAGCCTTTGGCCTGCATGGACTGGACTATTG
GATGCCTCTGAACCACCCCCACCCCCAATAGAATATGAGGGGTCTGGTGTCTCTACAGCC
TTTCCAGACAATGGTGAGTACTTTCAGCCAACAGGGACTGAACTGTCAGGTGCCTGTGGA
TCCAACCCCATGCCTATAAGAGGATCGAAGGGGGCTGGTGTTTCTTCAGCCTCTCCAGGC
AATGGCAGGTATTCTTGGCCTAAAGGAACTGAACTGTTGAGCACCCATAGAATCACCCCT
ACAACTCATAGGATAGGAAAGGACTGGTGATTCCACAGCCTCTCCAGGCAACAGTGGGTT
CTCTCAGCCTACAGGACTGAACAGTTGAGCATTTGTGGTTCTGTTATCACCCACTAAAAT
GCAAAAGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved