Dasypus_novemcinctus Locus Poly:4:SNORA73
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Poly:4:SNORA73
Dasypus_novemcinctus
Poly:4:SNORA73
scaffold_27466
SNORA73, SNORA73, SNORA73
1001..1204, 1868..2072, 2303..2507
3211
GTGGGCAAATTTCCCAATCCTGTGTTATCTGAAGCATGCCAAAAGTCCGTCCTGTTGTC
ACGGATATTGTATTAATGAGTCTCCGTGACTCCTTTTTAAGCTGCCACCTCAAGGGTATC
AAGCTCCTTGTGCTTAAAAAAAGTTACAGATCTACTGGGCCATAAGGTGTCCCTGAAGCC
AATTTTGTGGTTTTGCTTTGAGATGTTTTCTTATTCCTGTAAGCAGAACTGGGAAGGTCT
GGTTGATATCCATCTAGGAGTTAAGAACAAAGTATTAGATAGATAGAAAACAAGCTTAGC
TATAATTCTGGGTAAGAATATTAGAAATTTTCCAGAAGCTGCCCTAATTGAAGAAAATTT
TTAGTAAGCATGTTTTCCAGGAATACAATTCCATCTGAGTTTTAAAGAATACTGATACCC
GGGACTGTCCCAGGACTTTACTCTTTTTGCTGTCTTGATGTTTGTGGGTTGGGATACTTA
ACCACTACATATCCTTGGGTTTGGATTTAGGGTTCATGAGACCTGTTAGTTTTTAGATAT
TTTTCACTTGGGATACCTGGCAGGAAGTTAATTAGGATTGCTGTTGTGTGGCTGATTGGT
CTTGAAGCCAAATATGGTTGGTGCTTTGATGGATAAGGGAAAGATGCTGTCAACTAGATT
GTTTTCTTCTACAGTCTTCGAATTAAACCGGATATAGTTGCCTTTACAACGTGGATACCC
CCGAGATGTCACTCTCCTCGGGCTCTATCCAGGTGGCTCAGGGGAGCATAGGGCTCTGCC
CTGTGATGTACGATCCCATTCCACACGTTGGAGAGGAAGCCGGGCCTTGAGCTTGCACCT
GCATATTCCTACAGCTTCTCAGAGTCCTATGGACAATGACTGAGGAGACAAACCATGCAG
GAAACAGCTCTCCAGGGCACTCTAATCTGGATCTAGGTTCAGTTTACCATGTGTCTGAGA
GAAGTGCACTTTGTCTTATTTGATCTATTGGTGAATTACACTTAATACTTTTCTACCTTT
GTTTTACAGAATTCTCACAGAATTCCAAAGTAGCTAAGATTTGAGGTGAGTAAATATGCT
CTAAATTGCTTTTGGGCTTACCAGTTTATCACCTGTAAACATTTCTAATGCATTTTGTCA
TTTAGGGGATGTTAAGATGTTTCTGTAAGTTTCTTGACGGGAATTTTTAAAAAGCTTACC
CATCAGAGAGAACTATTGTACACACCCTTATCGATACCTGTCTACTTTTCAGATCAAGAA
ATTGAGATGGGTGGAGTGGTTTGGCCAGTCAAAAATTTTGCATATGTGTATTCCCTTTGC
AAGTCTCACCAACTTCTCCAGCCAAAATACTTAGACCCTGAAGGGAAGTGGCAGTATCTG
TTGATGTGATTTAGAACTGGTTAAAAACTATTACTAACCCTCTTGGTTGTTTTTTCTGTT
TTCCTCCTATATACTAGTTTGTATAGTCCAAGATGAATAAACTGGAAGCTCTTGAAAATA
TAAAACTGGTGATATGTTTATTATAAAGCATTGTTGCTTTTGTAAATTACACTAAAGACA
ATGACTAGCATTCCAACGTGGATACCCCGGGAGGTCACTCTCCCCGGGCTCTGTCCAGGT
GGCGCAGGGGAGCACAGGGCTCTGCCCAGTGATGTACAGTCCCATTCCACGACGTTGGAG
AGGAAGCCGGGCTCTCAAGCCTGCACCTGCATATTCCTACAGCTTCTCTGAGTCTTATTG
ACAATGACTGAGGAGACAAACCATGCAGGAAACAGTTTTCTTGAGCATCCCAGTCTGGAT
CCAGGGTCAGTTTACCACATGTTCAGGAGAAGTGTGCTTTGTCTTGTTTTTAATCTATTG
GTGAATTACATTTACACTGTGTACCTTTGTTTCACAGAATTCTCAAAAGAATTCCAAAAT
ACCTCAGATCTGAGGTGAGTAAAATTGGTGTTATATTTATTATACAGCATTGTTACTTTT
GTAAATTACCATACAGTGACTAGCATTCCAACGTGGATACCCCGGGAGGTCACTCTCCCC
GGGCTCTGTCCAGGTGGCGCAGGGGAGCACAGGGCTCTGCCCAGTGATGTACAGTCCCAT
TCCACAACGTTGGAGAGGAAGCCGGGCTCTCGAGCCCCCACCTGCATATTCCTACAGCTT
CTCTGAGTCTTATTGACAATGACTGAGGAGAAAAACCATGCAGGAAACATATCTCATATT
AAAAATTAAAATTCAAAGACCTTAAAAAGGAATCTAAACCTCTTTTATGTTTGTGTACAT
TCAGGAGAGAAGAGGAACAAAGCCTTGACATTGAAATATGAGGTGGGAAAGTGGATGCTA
TACAATCTTGAAGATGGTCATGGAGGGTTTGAAAATTGGCACAGCTATCTCCATTTTTGG
CTTTTTAAGAAACTGAGTAAATCCAAAAATTCCAGCTTTAAAGACAGAATCATGGGAATT
GGCTAGAAATGCAAATTTTCAGGTTACCCCAACACCGTATAACAGTTTAATATCTAATGT
ACTAAATAACCCATGTATTCTGAGAATAAGAGCAAAGTAGATTAGCCTTTTAAACTAATG
TATTTATGAATTCAAATAAAGATGAATTTGAAATTGTTGTGGTTTCTTTTTTAAGCAGAA
ATGTCATGGTCAAGCCTATGAATGGTTGTACTTGTTAAGCGGCACTAAAACTGCCTTTGG
CAGTTTTTTTTTATTTGATGAGAAAGAGTAAGTCCTTGAGATCTTGTTCAGTCCGTTTCT
TTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCTTGCCA
AAGCCCCTGCACTGGCTGGCAGCTCCTGGAGATCCTGCAGGATGGGGGCAAGGGGAGCTC
CATCTAGAAGGTAGTCTACTTTGTAGAGTTTTGTAATGCAGAGGTGTAGGATGGAATACA
TATGAGCCTTTTATTATAGAAACCAGTTTTGAGGGGTTTGGGTGAGCTGGCCTGCAAGTC
GTCTAGGTAGGCAGTTGGTAATTGATTTTAAGGTGGCTAAGTATCAATTTAACCCATCCG
CAGATGGAAGAACCTAGAAACACCCAAGTTCACATAGTGATGCTAGAGTCTGCACAAATG
CAGAACACAATAGGCCCTGCTAGGAAGAATTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved