Dasypus_novemcinctus Locus Mono:39:SNORD38
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:39:SNORD38
Dasypus_novemcinctus
Mono:39:SNORD38
scaffold_12846
SNORD38
1001..1070
2070
AAGATGATGCAACAAAAAGAAACACAGATTCTAGTGCTTCTGACACAACAGAGGCGGAC
AAGAGACATGCAGCAAACAGACACAGAGAACAGACAAATGGGGTGGGGCGGGGGAATAAA
ATAAAATAAATAAAACTTTTTTTTTAAAAAAAAAGGGGTATTTTTAAAATATTCTTACCA
CTGTAATAGTGGAATACTGTATACAATATTTCGAGTAGATTTTTTTAAAAGATTATTTAT
TTATTTCTCTCCCCTCCCCACCTCCCCCAGTTTCTGCTCCCTCTGTCCATTTGCTGTGTG
TTCTTCTGTGACCACTCCTATCTTTATCAGCGGCACCGGGAATCTGTGTTTTTTTTTTCG
GTTGTGTCATCTTGTTGTGTCAGTTCTCCGTGTGTGCGGCGCCATTCTTGGGCAGGCTGT
ACTTTCGCGATGGGCAGCTCTCCTTACGGGGCACACTCCTTGCACGTAGGGCTCCGCTAC
GTGGGTGACACCGCTGTGTGGCACGGCATTCCTTGCATGCATCAGCACTGCGCGTGGGCC
AGCTCCACATGGGTCAAGGAGGCATGGGGTTTGAACCGCGGACCTCCCATGTGATAGGTG
GACGCCCTATCCATTGGGCCAAGTCCGCTTCCCTCAAGGAAATTTTTGAGCAACAGACCC
TCTAGGCTATTGGGTTAGACTGGGAATCTACAACCATTTCTAACACTAAAATTCAAAATG
ATTTTCCAAGGCAAATAATCTAATGTTGTTTTATAAATTGGAGGACTACCTGCCTATATT
ACATGACAGTAACTTCTTAGCTGCATTTCCCGATTCCTGAATTGATTTTTTTCCCAAAAT
GGATGATTTTATTCCATCTTGAACATGACTGATTAATTTTATTTTATACTTTTCTGTTTT
GTTTAAAGTCTTTACCATGAATCATACTTTTTTCTTTTTAGTATTTTCTATTTTTAAAGA
AGCTTTTAGATTATATAAATGTTATATCAAAAATATAGGGGACTCAGTGATGAAAACTTA
GTCCAGTTCTGCTACTGACTGTAAGTGACAATAAAGTATTACCTGAGGAGACAGAGGGTT
TCATGCTTGCCCTCGGTCAACATGGATTTCTGAGGGATAGATAGGTTTGGAGGGCTGCTC
TGTCATTTTGCTAAATGCCACATACTCTCTTGCATTGCTTCAAGGCCAGGCCAGTGTGGC
TGAGCAGATGGCTATGTGCCAGAGGGCAAGGAGCTGGAGTTCTGTCTGAGGAATATCAAG
GCTCAGAAAGACAAATAATTCCTCCCGCCCATCCTAGCTCATGTAATAAAGATGTTTGTT
GTTCTATTGGGGGGGGGGCGAAATATATATATAGGGGATTCCCATATACCCCACCCCTCC
CCCACCACACTTTTCGAAATTAAAATTCTTCATTAGTGCGCTACATTTGTTAAAATTGAA
GAACACATATAGAAGCACTGCCACTATGGACTATAGTTTACTTTATAGTTTACACTTTGC
CTCTCACAATTTTATAGGTTTTGAAAAAATATATAATGGTCTGTATCCCTCATTGCAATG
TCATGCAGGACAATTCCAATATTCCAAAAATGTCCTCATTGAACATGACTATTTAAAAAA
AAATGTTCGACATGCAACTTCCCCTTTTCAAAAATCTATGAGCGGAGATTACAGCAAGAT
GGCAGTGGAATAAGGAGCTCCTAGAGTCAGTTCCTGCTACAGGGCAGTTAGTAAACACCC
AGAGCTCTCTGGGGCCAGCTGAAGTACCTGTTTGGGGGCTTTAGGAGGCCAGAAGGGCAT
CCTACGACATCACTAGAAGAATAGAAGGAGAAGACTGCCCATCTCCAGAGAAGACTCATA
AGTAGAGAGTTCCATGCTACGGAGGCCAGTGCCCATCCTCCACTGTAGGCACAAGCTGCC
TAGGGAGCTGTTCCATGGCTGGAATTGAAAGCTCCACTTCCCAAAAACAGGGGAGGAAGA
GATGGTTGGGCACCAACTTCAGCTACTGATGGTAAAATTCAGCAGGCTACAATACAATCC
TGAGAAACACCTAAAAGTTTGAGCCTGTCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved