Dasypus_novemcinctus Locus Mono:281:SNORD14
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:281:SNORD14
Dasypus_novemcinctus
Mono:281:SNORD14
scaffold_163950
SNORD14
1001..1092
1988
NNNNNNATGTTAAATTCTTGAAATTGACAAGACGGTTACGTAAGTGAATATCCTTATTC
TTCAGAAATATATGTGGAAGTATTAAATGTTCAAGGAGTATGAGGAATGCAATCTACTCT
CAAATGTCTCAAAAATAGATCGAAAATAGACAAAGAATGATGTAAAGAATGATATTTTAG
CAATGTGCTAAAAGTTGGTAAATCTGGGTATTGGTAGGGGGTATAGTGGAGTTCTCTGTA
TTGGTTAATTTTTTTCCTTTTTTTATTTTTAAACAAAGTCACAATTTTATTTATTTTCCA
GTAAGTTTAAATCCTTGAAGGGTGCAGAATTACATGGATTTGGTGTCCAATGGCCTGAGG
AAGACGTTTGCTTTGGAATTTTATACAAACCATGTCACTGTTCACATAGAAGCGAGTTAC
CTTTCCCTAGATTACTTTGGTTTTGTTAGATTTCTCAGTAGGAATCACTTTGTTGTTTTT
TAGCTTTGTGCACATAAGCATATCTCTTGCCCAATTAAATTCCATTTCATCTTGGGCATA
AATGCTATCAGTTTGAAGATGAGCTGTGTGCTCTCTTCTGGCTCTGGAGACCTCACTTAC
AGGCAGCGCAAAGGACCACAGCCTTCCAGACATGATTTGCTCGCCTTAGAAGTCTCTCTT
TCTAGCAGGTCTCTACAGGGCTCCAAGATGGGCAGAAAAAGCTAGGTGTTATTTTTGCAG
TGGTCCTGTAGGTTTAAAATGATTTCAAAAGAGAAATGAATGAAAAATATACATTTAAAG
AGGTCAAATATGCATGAGAAAACAAGTTAATACTTATTAGAAGCAGAGTTTTTATTAGAG
TGATGGAAAAGTTCTGATAATGGTGATGATGGTAGTATAAATTGTGAATGCAATTAGCAC
CACTGAATTATATACTTGAAAGTGGTTAAAATGGGAAATTTTATGTTTTAGGTGTTACCA
AAACAAAAAATTTAAAACAGCAACAACTATAACAATACATATCACAATGATGAATTGTCC
AAACATTCGCAGTTTCCACCAGAATTTAACTTGTGTTGGCATAGGTACCTTCCTTCCTTG
GATGTCTGAGTGACCAAGGTTTCGTGGAGTAGCCAAGGCCTTGCTTTTTATTATCTTTTT
TTTTTTTTTTTAAAGATTTATTTTTATTTATTTAACTCCCCTCCCCTCCCCCGGTTGTCT
GTTTTCTGTGTCTTTTTGCTGCGTCTTGTTTCTTTGTCCGCTTCTGTTGTCGTCAGCAGC
ACGGGAAGTGTGGGCGGCGCGATTCCTTGGCAGGCTGCTCCCTCCTTCGCGCTGGGCGGC
TCTCCTTATGGGTGCACTCCTTGCGCGTGGGGCTCCCCTACGCGGGGGACACCCTGTGTG
GCGCGGCACTCCTTGCGAGCATCAGCACTGCGCATGGGCCAGCTCCACACGGGTCAAGGA
GGCCCGGGGCTTGAACCGCGGGCCTCCCATGTGGTAGACGGACGCCCTAACCACTGGGCC
AAAGTCCGTTTCCCGCTTTCTATTATCTTAACCCAGGCTCTTAATGTATAAAGTTATATT
GAGCATGTGTCCTAGGAAAGGTTCTAGATGTGTGGGGGGAATATTTGCTAATAAAACATT
GTCTCCTTTCCCCCAGAAAAAAAAAACAAAAACAATACATATAAAAGTACAACACATAAA
GAGTGAATCCTAGTGTAAAGTGTGGAATTTAGTTAATAATATTATAATACTGGCTCATCA
GTTGCATTAGTGTACCATACTAAAGCAAAATGTTAATAAAGGGGGAAAATGTGTGTGTCA
GGGGGATAGTATCTGGGAACTCTACTTTCTGCATAATTTTTCATAAACCTACAACTCCTC
TAATATATATATTATGTATATATAGGGGCTAGAAAATCTGACAGGTACGCAGACAAAGAG
GCTCAGTTTAGTGTTCCTACATGAAAACACGCTTCTGAAAACAGCTCACGTATGGAGTTT
AGCCACAGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved