Dasypus_novemcinctus Locus Mono:118:SNORA77
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:118:SNORA77
Dasypus_novemcinctus
Mono:118:SNORA77
scaffold_43302
SNORA77
1001..1125
2125
TGGGCAGCCTGGGCTGCAGAGGGTGCTTCTTCCAGAGGCATGTCCAGGCTGTCTGAAGC
CACAGCTCTGTGTTTTCCCCAAAAGCTGAAGTGTCCAGACACGTCAAGACCTTTGGTGCT
GCCATAAGCAATTGCGTTCTCACTGGGAGCCTTAGCTTTTTGTCCAAGCTCTAGTGTCAG
AGTGGGAAGTGAGACTAATCCCTTGGGGACCCCCCATGCTCCCCTCCTGGGCAGACACAC
ATGTGTCTCATTCCTGCCTCACGTCAGAAGCCTGCATGCTGCTCTCGCCCTGGCCCATTC
CTCCTTCCCGCCTAAGTTTAAGCTCCTTTAAACCCAAGGCCATGACAGCTGGTCCAGCTA
GCGCAGACATGTGTGACCAGGTCCCCAGGCAGTGGCACATTTCCTCATGGCCACCCAGGT
ACCCTGGGAGCTGTAAGCTAAGGTGTATTGGCCCAGGCAGGCCTGGCCGCTACCTAAATT
TTTCCACAGTTCTACCTGGGAGAGCCCTGGAGGGTCAGATGGGTGGCATGGGCTTGGTAC
CCTAAGTGGCTGACCATATGGTGTTGAGGGAAACTCACCTTTGCTCTGGGGTCTTTGGCC
TGTCAGGAGCAGATCCTCTGGCGTGGAAGGACATCACCCACTGGGGTGCCCAAACCTTTG
CCCTCCAACCAGATCTGCCTGAGACTTCTGTCCGAAGGGAGGCAGGGGTAGCCTGGTACC
CAGTCTTGAAGGATTTGGGCTGCCATAGCTATGTGGCCTCTAGTCCAGTGGCCCAGACTG
TCCTTAGGTCAGAGATGGCCGTCGGATGGGCTCTTGGGAACCCCTTTCAGACCACGCATT
TGTGTCCCTGTGCTGGGACTGCTCAGATGCTTATAAACATCTCTTTTTTTTCCCTAGATG
CACAGAAATTCAAAAAGAAATTTGAGGAGTGCAGGAAAGAGATTGAAGAGCGAGAAAAGA
AAGGTGACTTGGTGTCCTGTGAGGCAGGGTGGGGGCTCCTCGCAGACTCACTCTGCATCC
AACTGCAGCCCCAGTCTGGGTGCTTTTTTCGTCTGCCAGAGAAACACCTGGCCGCCATGT
GGGCCTCGACTTGTCGATGGCACTGCAGCTGGCCGGGGACAGTGGTGCTTCTGGGGTGGG
CTGGGGCTCAGGCCTGTCTGTCTCCATACCCCTAGCCACTAGGAGCAGGCCAGAATCCTT
TCAAGTTAAAATTACTTGAGGTGGCATCCTGGGGCAATTTCCTGCATGGGGTGGTCATGG
TAACAGGTCACTAAGAATTACAGTGCCCTGCATGATGAGGACACTTGTTCATTTGGGCAC
CACCTTCTTTAACAACTGGGCTTGCCCTGGGGGTGATGGAGAGGGATGGACTGTCAAATT
TGTCTCAAGCAGCTGCTGGTTGTGGCCGGGGTGACATCATCCTCGAAGGGCTAGGTGAGG
CAGGCTGAGTGCTGGGGCCTGTTGGGGCTCCTGGGCTGGAGCGTCTCACTCTCAGGTCTG
GGCAGTCACACATTTCTGCTTCTTAAACCATCTTTCACTGCAGGCTTGGGCAAAAANNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTCACTGCAGGCTTGGGCAAAA
ATGATAACGCCTTAAAAGGTGGCTGAGAAGCTGGAAGCTCTTTCGGTGAAGGAGGAGAGC
CAGGAGGCCCCTGGGAACAAGGAGTCTGAAGAGGAGGACACCAAGGAAAAAGTCGAAGAG
AAGCAATAAATTGTCTTACCCTGTTTCCTTTTCCTTCCTTTTTCTTTTTCTCTTTCCTTT
TTTTTTTTTTTCCCTCTACCCCTTTTTTTCTGTTTGTTTTTTACAAGGGACTTTATATAA
AGAACTGAATTCCATCCCAGCATTCAGGTTGTTAATTTTTTTTTTCCCCAAGTTTTTGCC
CTGTCAAAGATGACTTCAGAAAATCCATTCCCCAGTCATGAAAATGTACTGTGCTAACTT
TCTTTTCCATAGTGGAAACACTTATTTATAGTCATCAAATATAGTGAATAAAAACAATTT
GAAAATGACGTCTGATAAAATCATAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved