Dasypus_novemcinctus Locus Mono:277:SNORA64
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:277:SNORA64
Dasypus_novemcinctus
Mono:277:SNORA64
scaffold_159953
SNORA64
1001..1145
1745
ATACTACAAAGCTTCAGGTGTCAAAAGAGCATGGTAGTGGCACAAAGATAGACATATAG
ATCAATGGAATCAAATTGAGAGTTCAGAAATAGACCTGCACACCTATGGTCAACTGGTAT
TTGACAAGGCTGCTAAGTCCACTCAGCTGAGACAGAACAGTCTCTTCAACAAATGATGCT
AGGATATCTACAACCACAAGTATCATACCCATATGTAAATTAACTCAAGATGGATCAAAG
ACCTAAATATAAGAGCCAGGACCATAAAACTAGAAGAAAATGTAGGGAAGTATGTTCAAG
ATATTGTGGTAGGAAATGGTTTCACAAATGTCACACTCAAAGGATGAGCAATGAAAGAAA
AATTAGATAAATGGGATCCCTCAAAATTAAAAACTTTTGTGCTTTAAAGGAGTTTGTCAA
AAGAATGAAAAGACTGTCTACTCAATGAGAGAAAATATTTGGAAACCATATGTCCAATGA
GGGTCTAACATCCAGCAGAGATAAAGAGACTCCACAATAAAAAAAAAACAACAACCCAGT
TTAAAAATGGGTGAAGGACTTGAATAGACATCTTTCCAAAGAGGAAATACAAGTGGCTAA
AAAGCAAATGAAAAGATGACTAACATCACTAGTTATTAAGTAAATGCAAATCAAAACCGT
AATGAGATATATCATTTCACATCCACTAGAATAGCTACTATTAAAAACAAACAAACAGAA
AACTACAAGTGTTGGAGAGGATGTGGAGAAATAGGAACACTCACTCACTGCTGGTAGGAA
TGCAGAATGGTGCAGCTGTTATGAAATACAGTGCGATGGTTCATCAGGAAGTTAAATACA
GAATTGCCATTTGATCCTACAATCTCATTACCAGGTAAGTATCCAGAAGAACTGAAAGCA
GGGGCATGAATAGATATATGCACACCTATGTCCATAGCAGCATTACTCACAATTGCCAAA
AAATAGAAGCAACCCTAATGTCCACCACAGATGAATGGATAATTCTCTCAGCTCTGCAAA
GTTATACCTGCAAGGTTAGACCTAACATGTGTGCCTTCCATAATGGGAAAAGAGAGTAAA
GATCTCCTGGGGACCTCAGATGGGCCTTGCTGTAGCCTCTCTTACTCCAACAGGCATGTC
ACGTAGTTGAGGGGTGACAGCTGTGTGGGCAGCAGACTTGGTCTGGTTGCATCCCCATCA
CACTATCCCTTTGCAGGCCTTTGTCACCTTTGGGAACTACAATGGCCATGTGGGTCTAGT
GTGAAGTGTTCCAAGGAGATAGCCACTGCCATCCATGGGGCCATCATTCTGGCCAAGCTC
TTCATTATCCCTGTGTGGCAGGGTTATTGGGAGAACAAGATCGACTAGCTCTATACTGTC
CCTTGCAAGGTAGCTGGATGCTGTCACTCTGTGCTGGTGCACCTCCTCTTTGCCCCCAGA
GGTACTGGTATCATCTCGGCCCCCATGCTCAAAAATCTACTGATGACGACTGGTATCAAT
GACTGCTACACCTCAACCAGGGGCTGCACAGTCACCTAGGGCAACGTCGCCAAGGCCTTC
TATGATATGCCATCTCCAAAACCTACAGCTGTCTCACCCTCAAACTCTGGAAGGAGATTG
CATTCACCAAGTCTTCCTACCAGGAGTTCACTGACCATCTCATCAAGACACACACCAGGA
TCTCCATGTAGAGGACCCAGGCCCATCACTGTGGCCACCACACCTCACTGTGGCTCTCAC
ACATGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved