Dasypus_novemcinctus Locus Poly:3:SNORD115
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Poly:3:SNORD115
Dasypus_novemcinctus
Poly:3:SNORD115
scaffold_24931
SNORD115, SNORD115, SNORD115
1001..1078, 2786..2860, 4605..4680
5680
TATATCACTGATTGTACACTTTGGATGGATTTATGCTTTATTAATATGTATCAATAAAA
ATGATTTGTTTAAAAAAAAGTGTTATTAATTACGACTGTTGGTGATCATTTACCATAAAG
CCCAAATGGCACAAGTGTTCCTATAACGTGAGTGCCAATATTTATCTTCTCAAAATATAA
TTGAGGTATTTCTTGCATATTTATGAAACAACCTGTTTTATGAAATTATGTGAAAATTAC
AGTGACACCTTTCTAGATCCATGGCTATCTTCTCTCCTTGAGCTATTTTTTTGGTTCAAA
TCGAAGCATCTTACTAACATCAACATTTTGTTCTGTTAGATCTGATTTTGGGTATTTTGG
GGGGGCACTGTGAACATTCACAACCTCAGAAGAGGTGCATTTCCACTGTAAGGATGAAAT
TCCTGTTTATATAATGCTAATGAGTCATGAAATGTCAAGAAATATGAGCAGCCTACTATT
GAATTTTTAGATCCAGGTTTTTGAATGTTTTTCAAAATCTTCATTCTGAGAATTCAGTTG
AATTTACCATCGCGGTTGTTATATTTTTCTGATATTTTTGTATGTAGACTAAGGAAGATC
AAATGGATGAACTGATTTTGCATGAAAACTCATTGTATGTGTTGTAAAATCAGGAAACTT
GGATTTTTTCCCACTTTTTGTTCCCAAATCAGTGGTCTCAAGCTTATTGTGGATAGTATT
TGAAGATGTACCATGGTGGTCCACAGCACTAAAGGAATCAGAAGATGCACACCCTTCAGA
GCGATGCTCTCACTTTGACCCCTGTCCCACCATCTTCACACAGATGAACACTTTGGATGT
GCAGTCTGTAGGTTTTCGGCCCTTGGCAATTTTTGCCATCACTATATACTACAAGAAAGT
AGTGGAATTCTAATTCAATGTAGCCCATCGATTTCAGGAAAAAGCCTCTGTTTAGCATTT
ATTAGTCAAAGAAGATGCATGCCTTGCAAGTATCCTACCTTGGGTCAACATGAGAACTTA
CCCTTTTAAAGACAGATGATGGCATGAAAAACATACTCAATAGGATTACAATGAGGTCCA
ATCCTCAGTGACAAACCAGGGATAAGAATTTTTGATTCTTCATTTCTATTCTAGTTCATT
TTATGGACGGTTGAGACAGTACAAACATTGGGACAAATTTGAGTTCCCTTACCTACCAAT
ATATTTCTATGAAAGCCACAAGTTTGGGGTCTTGAAGCTTGCCCTGTGTGTTTTATTTAT
CTTAGCAATCTGCCCTAACTCTGCTCAATCCTCAGGAATTTTTCACCTGTGTCCTTCAGA
AGGAAAAGCTGAGGAGAGATGAGCCTTCCACGTGGGACATGAGTATTTATTTTTGCCTGA
CATTTTGTAGTTTAAAATTTCAGCTAGTGAGTCGTACCCCTCAGGCACTTAACTTTTCTT
TTCAAGAAACTTGAATTCCATTATTAGAGTTTTTCTGAATGTGTGTCAGATTATTATTTT
CTCTTGAGGAAGCCATGACTAATTTTCTGGACTTGATATAGTTGGGATTTGAGGAGATTT
TGGCTCCCGTTTATATATCCATTGGACATTCATTTATATCAATAAATTCAAGATGCCCAA
ATTTGTCTCAAACCACTCAATATTTTAACTGATGGGCTCTTATGAGTCAATGATGAACTT
TCATCCTAAGGGACACTGGAATATATGAGAGAAAATATTTAGAATCTTGAATGTTGTTTG
GCATGAAACATGGCAGCATATACATGGGTGAGTAAAGAACTAGCATATCATATATCATGA
CTCTCCAGTCGTATATCATGACTCGTATATCATGACTTCGTATATCATGACTCTCCAGTC
TCTTCCACTCAATGACAGTACTTGGAATAATTATGGAAGCTGGTAATCTAATGTCATAGA
GACAAACCGATTAAAGTGTTCAGACAATGTGAGTCCCAGGATAGCTTTATCGTCTTGAAA
CTTGATCATGCTAGTGCTTGACATCTTCATGTGAACAGTTACTTTTAAAAACTTACATCA
AATTTGCAGGAGGCATTTTCAGATCAATGATTTTCTTGTCTCTGTGAGCTACTTGTGAGC
TATTATTTGTTTTTGAATAATGAAAAATGTTACTGACCCCTGCCTTACTATTGCCTCTGC
TCTGGTTTGGGGAAGTTCTTGGTGTAGTGTGAACCCTGACAATGCAAAAAGAGGGACATT
TACTGTTTAAATGTGAATTTCCTGGTAATATCTGGCACATGTGTCTGGAAAAAGGCACCA
AATATCAGCAGCTTATTTTTATATTTTTGATCCAGATTTCTGAAATTTCGTAGTAGCAAA
ATTTCTACTATGAGAATTGAGCTGAATTCACCATGCCACTAGTTAGAGCTGTTTATATAA
GCTAAGGAAGATCAAAGGAATGAACTGGTTTTTGCATGAATACCCTGGTCAGGTATTCCT
CATTCAGCAAACCTGTAACATGTTTCCTGATCAATGATCTCAAGCCATTTAAAGGATCAT
ATTTGTAGACTGTGTGCTGTGGCCCACGACCTTATAGGAAGCAGTGGTAGAATAACCTTT
AGAGCAGTGTTTTATCCACGTTCTCCAAAACGAGCGCTTCTGTGGAAGTGCAATCTGCAG
TTACCGAGGCCTGGGGCAATTTTCCAACAGTTTGTACTGCATTAAAGTATTGGAATTCAT
TGTGACATAGACCAAGTCGTGAGGAGGAGTGTCTTGTAAACATTTGAAATTCAAAGGGAA
TGTATGCCCAGAGAGAGCAGGGGCTTGTGCCAATGAAGAGAAGTTATCATGTCGAAGACA
GATGACATAAAATTCACCTGAAAATGATTACACTGAGGTCCAGTCCTTGGTGACAATCTG
TAGAATGGAATTAGTGATTCTTCATTTCTAGTTTAGTAAAGTTTATATGGGATTGATGCA
ATGAAAACATTGTGGCCAAGTTCACTTTTTCTTTTGCTTAGTATATCTATATATGGAAGA
CACAAATTTCCATCCTCGAAGCGGGCTTTCCGTGTTCTGGCTTTTTCTGACAACTGGCCT
GTATATATGATCAAATCACTGCAGGTTTTCACTTGAGCCCTTCAGCCTGAAGATCTGTGG
AGGGATGAGAGGTGAGTGATTTATTGTTGACCAATATTCTGCAATTTGAATCTTCAATAA
GTGAGCAATAGCCCTCACACACCTAGCTTCATTTATTCAAATAACATGAATATCTTTATG
GGATTTTTTTTTCATGTGTGTCTTAATAATTGATGCTTTCCTCTTGAGGAAATGCTGACT
TACTTTATGAACTTGATAAGATTGAGTTTTTTAGGAGATGTGGCTCAGATTTATATGTCC
ATGCAAATATTCATTAGTCTCAATAAATTCAGAATGCCAAAATTTGTCTCAAATCATTAA
ATTGGTTCACTTAGTTAAGTTCTTTTTGGCCTAATGATTAACTACCATCCTTAGGGACCT
TGGAATATATAAGAGAAAATGTGAGAATCACGAATGTTCTTCAGTACAAAACATGGCAAT
ATATAAATGGATGACTAAAGTGATAGCAGAATTTCAGCCCCTCAATGTCATTACTTGCTA
TTTTCTTCCCTTTAAGGAAGGAACATGATATTCTTTATGACATTGATAATGAAACATCCT
AGAGACCAACTGGTTCAGGTGTTCAGACAAAATGAGTCCCAATATTGCTTTATCTTCTCA
AAAATGATTGAGCTAGTTCTTGGCATCTTCGTGAGAACTACTTTCTTTTTATAAAATTAC
ATGAAAAGTACAGTGAGGTATTTCTGGATTCATGGTTACCTTCTCTCCATGAGTTATTAT
TTGTGTCCAAATAAATGATGACTCTTCCTGACCCCTACCTTGTTGTTCATTTGCTATGAT
TTTGAGAAGCTGTTGGAGGCATTGTGAACACTCACAACCCAAGAGGCAGGGCATTTCTAG
GACAGGAATGAAATTCCTGTGAATACATCACTAGATTATGGGAAAATGGCTCCAAAAGCC
ATTGGACTAATATCAGATTTGTAGATCCAAATCTTTAAAGGGTTTTTTAAAATCTGTATT
ATGAAAGTATAGTTGGATTTACCATGGGAATAGTTACAATTGTCACTAATTTGTGTTTAT
AGACTAGGGTAGATCAAAGGGATATTCTGGTTTTTGCATGAAAATTCTGGATACATACTC
CTAATTCAGCAAACTTGTGATGTTCTTCACTTTGTCTTCCCTGTTCTATGGTATCAAATA
TTTTAATGAATCATAATGGGACCATGGTGGCACATGACATTTTTGAGAAGAGAGACTGCA
CAGCCTTGAATAGAACTGTCAGTTTGACTAGTGCCATACCCGTGTTCTCCTGCATGAGGA
CATCTGAGGAAGTGCAACTTTCAGTTGCATGGCCCTGGGACAATTTTAACAGTAACTTGC
ATTGCATTTAAGTAATAAAACTCCTCCTGAGATGTAGCCTGCTACTTTNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGAGAGTGCTGGCTTGTGTCTATGAGAATT
TAACTTGTTGGAGACAGGTGATTACATAAAAGTCATGCTCTACAGAATTATGCAGAGAGG
CCTAATCCAAGGTGACAAGCCAAGGACAGCAATTAGTGATTCTTCATTTCTATTGTAGTG
TTGGTTTTTGGGAATAAAGTAATGAAATATTATGGTCTTTGAGTGTCCCTTTTGTACTGA
TAGTTTGTATGAAAGCCACATATACTGGTCCTGGATGCCTGCCTTTAATATCCTTATTTT
TCTTAGCAACCAGACCTACCACAGGCTCAATTCACAGCAGTTTTTTTTTTATCTGTGTCT
TTCAGAGGGAAGAGCTTTGGGGGGATTCAGTCTCCCATGATGAGAGATGATTTAATTTTG
ACTGACATATTACAAATTGAAACTTACAGAGAGTGAACCTTACCCTAGATGGAGCTAACT
TAACTCATTCAGGCAACAATCTCATTATGGACTTTTCTTCGAGCAAATGTCTTATCAGTT
GAGTTCTTCTGACAGAAATCATGACTTTTGTATGAACTTGATATGACTGGGAATTGAGGA
GTGTTTGAACTCCCCTTTATATGTGCAGGTGAATGTTCATGAAGGTCAATAATGTCAAGA
TGCCCAATTTTTATCTCTTGTATTTAAGTGGTATTAACTGATTTGGTCTCTTTAAGGGCC
ATTCATAAACTTCTATATTGTGACCCTGGAATATGAGATAAAATATGAGATTCACAAGTG
TTATTCTGCATGAAACACTGCAATGCATATGTGGATGTGTAAACTGATAACTGTATTTCA
GCCCCCAAATATCATACCCAAGTTTTTTTTTTCCCTTTAGGGGAATGGTATGGTATGATC
AATAATCATTGGTAATTAATGTCTTTAAAGACAAATTGAGTCAAGTATTCAGACAATGAC
AGTCCCAATATGGCCTTGTCTTCTCATAAAGTGATTGAGCTAGTTCACTACATCTTCATG
ATAAAATAAACTCATTTTAAAAATTTACATGCACTTTACAATACTACATTTCCAGATCCA
TTGTTACTTGCTCTCTGTGAGCTATTATTTGGACCCAAATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved