Dasypus_novemcinctus Locus Mono:210:SNORA68
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:210:SNORA68
Dasypus_novemcinctus
Mono:210:SNORA68
scaffold_99272
SNORA68
1001..1118
2118
TCAATTCCTGTCCACGTTAAAGGGTATCAGAGGAAGCAATATGTAGCTGCATACACCGG
AGATGATTAAGAAGTACCAGCCAGCAGAAAAAATGCTATTTAGGTTAGTATGCAACTAAG
GAGGGAGTTGAGAGTGCAGGGGTAAAAAGCAGTGAAGCAGCAGCTGTCTCTAACTCCCAG
AGAATAAAGAGTACAGGAGAGATGGAGGGCCTGAAGGTTGGAAAAAAAAAAAAAGTAAAA
AATAGAAAGAAGATAACAAAGAGAAACAAAATACATTTCCTAGTGGTGCAAATGGCTGGA
CTTTAAACTCTTTGGAGTTAATTTTGAGAAGCCCTGGAAACAGGCAAAATAAAGACTCAT
AAGAGAAAACATCCACTTCACTTAGGTGAAGCAACAAAAGCGAGGGGAGGCAGGAAGGAA
GTGGATTTTAAATTATGGCTAATCAGTATCCAAAGGACAGCAGTCACAGGCAATTAAAGG
GGTATCAGAAATCTGCTATCAGTGGAATACAAATTCAAATGTTTTGTGAATTCAGATATA
ATTTTATTCATTGTATATATTGGATGTATTTCATTTCTTTCTCTCCTTCTCCCCCAGCAG
TTAAAATAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNGTACTCACGCAGTGCCGGGCACCCGGCCTGGGAGAGAGA
GCGAGGTCAGCAGCCCCCACACACCTGTGCAGTGCCCCCTGGAGTGAAGAACCTCCACAT
CACTCTGAGAGGCACAGCATAGCCCCCAAAGGTGATGAGGTTCGCTTGATGTTAGCACTG
CTGTTTGGAGAAACTGCGGTTCTTGGGTTTAGATGTGAGATTTGTTTGTCTGTTTGTTTT
TTAGGAGATACAGGGGATTAAACCCAGGACCTCGTACATGGGAAGCAGGCACTCAACTAC
TGAGCTACATCAGCCCCCCATCAGAGTTGGTTTTCTCGTTTGCTTGTTTTGTTGTTTTTA
GGAGGTATCAGGGATTGAACTGAGGCCCTCATATGTGGGAAGCAGGTGCTCAACCACTTG
AGGTATGTCTGTTCCCCTCACCAGGTTTTAAAGTACTGAAATCTTTGTTTTTCAGGCTGT
GATGAAAAAATATTGGAGGAAGCAGTGTCGAAGACAGGAAAGTAAAGAGTCCAAGGGGGG
AAGCCATCTCTCTCCATGCCCCACCAGTGTCTGCATCTCCTGGTCCCAGCCCTTCCAGGC
CTGCTCCCCCATGGACTAAGTCTCTGCTCACTATCAGGTGAAAAGAGAAAGTGTACATTA
AAGAACTGATACCACAAAAGAAAAGGTTGAACTGGCATTCTGGCATTTAAAATAATAAAA
AACTAAAAGTCAAACCCATCAAAAATCTTGATCAGCATTTCAAAGGCATTGTTTAATGGC
CTTTAAGTTAATAAAAGAATAGAAATCAAACCTGGCTAGAAGGACCTTTGTCTACAAAGG
AATGCCCTTGGTATCACTGGAATTCAATATTCAGGTAATAAAATTTCCATTCAGTAAACA
TTGTTCTATAAAGGAAGCAGTTCTAGTCCTATTTGGGGAATATAGATTGTTGATAAAATT
CAGAGAACATTATCTCCTCTCCCTATTTAAAGGATTCCGATTCCCCCATCTGGTAAAGCA
TCCAGTACAGTCCTTTAAAATCCTCGTGGCGGTGGGGGTGGGCATGAGGGGGCAGGGCAA
AGCTTTCAGAACAGGTCAAATTGCTTTTAGTGTTCTTTGTTGCCATGAAGGGACATTAAG
TATTGAGCTTCAAATGCTGAATTCACTAAAATAATGCTTTGCTTCCTCACCAGGATCAAG
ACATTTAAATCATTATTTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved