Dasypus_novemcinctus Locus Mono:330:SNORA12
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:330:SNORA12
Dasypus_novemcinctus
Mono:330:SNORA12
scaffold_250015
SNORA12
1001..1141
1822
AAGGGCAAGAAGAGGGATAGAAGCTTGTCAAAGAAAAAGAAAACTTGTGTTAACAGAAG
TATGAAGGAATCAGGTGATTTTGGGGTCACAGAAGCCATGGAAGAAGAAAAATTAATGAA
GATTTCCTCATCAATGTCAAGGATAAGAGAGTGAATATGATTGCTTGAAGTTTTTTGAAT
CTCAGAAAAGATCATCCTTTCTGAACTATTTCATTCCTGTGGATGTGGGGCCCTCTGGTT
GCACTAGATTCAGGGATCTTTTGATTAGATCACTTGATTAGACCATTCTAAGGCCTTTGA
CTGGACTATGTCAGTGAGGCAATACCCAGGTTGTCCCTCCACCCTCTTGCTGGGTACTTA
TATAACCTGAGAACTGGAAGCAGAAATATACAGAGAAAGACAACTGTCATTTTTACCCTG
CAATGGGAGAAATAACTTTACATTCACCTGCAGTTACAGAAAAACAAAGAAGTCCAGAGT
TGCTGATAGAGAGGCTAAGAGAAATCCCAAAAGGCTAGGCCAATGGAGCAGCTCAAAGCT
AAAGAGATGAGCCCTGCCAGTTGCTTGATTATAACACAGCTGAGATTGGAGAGAAAGAGG
CCTGGAGGAAAAGGCACAGACCCAGATAGAGAGTTGGCATTTTGCCTCATCACATGGCAA
GAGTTCAGGATCAAGCAGCCAACATTTGGTGAGAAAACATCACTGATCATGCCGCTATTT
GGACATTTTCAGTTTCAGGACTGTAAGCTTTAATCCTAATTGTTTCCCTTTATTGAAACC
AAGCCATTCCCGATATTTTGCTCCCAGCTTCCAAAGCAAACTAAAAAAGTGGACTATCAG
GATAAATGTCAGAAAATTCCCATTGGATTTGAAATTAGAAGGTGAGTTTAATGAGTAGAG
TTTCAATAGGATAGTAAAAACAGTAACTATTTTTAAAGTATACTGAAAAGTCAGGGAAGT
GTAAGGAAATACATGCCTTGTATGCCAATTATTCTTTCACAGACCATAGCTGAATGGCAG
ATTCATTAAGTTTTCAAATTTGCCCGATTCTGCCACATATAATATATAGCAGCTGGCAAA
GGCTTGATGACAAAGAGGTTTCTTGCAAGACTTTCCTGCACCAGAGTTTGGCTCCCCCAT
GTGGCAGGTTATCTCATAAGTTTAAGTCCTTTCAGACAGGTTGGCAAAGACCTTTCTGGC
TTGAGGAATCTGTGCTGAGGGGTATTTCTCTGCTCTTTGATGGATTTGCTACTTTGCAGA
AATTGTGCAGGTACCTCCACTATGGACTCTACACAAAGATACCCTCACTACATGCACTTT
CCCAGATTATCCCTGATACTCAGCTGCTGAACCACTAATGACATAAAGGACACCTTTATT
ACTCAAGTTCAGGAGAAACAGATAAAGCTTCTGGAAATCACAGAGCGCTCAGACAGCAAG
CAGATTGCACTGCCAGCAGCAGAATGTTTTACATTGAACTTGTCACAAGAAAGAAGCTTT
TCCACAGAACTAAAAGTAGAAAGCTTTTTAAAGACAATGAAGACTCCCATGGGAACTTTT
TCCCAGTCCTTTTTCATGCATTCATTTGGAACCTACCTTCAGCAAGAGGTCTAGGATTGA
ATATGCTTTTGGAAAAAGTCACATTCATGAAAATCCTTTATTGAAATACATCAGTCGTCG
AGTTTCAAATACAGCTTGTGTTTAACAACATTTTCAAAAACATTTAAGCCATCAATAAAA
TCCAAGAACTTACAAAAACATACATGAGAAGAGTAAACATATTGAGTAGTGACTAAAGAG
AAGGTAAAATATCAAGACATGTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved