Dasypus_novemcinctus Locus Mono:124:SNORA26
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:124:SNORA26
Dasypus_novemcinctus
Mono:124:SNORA26
scaffold_44796
SNORA26
1001..1121
2121
GAAAATGCACTAAACTTTTAATTTATCAAATTAAGCAACCTTNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTTTAGTATTTAGGGGAATGCAAAAACCAAGGCTTAT
CTAAATGTCTGGAGTCCTTGCTAAAAGCTTACCTAAGATGAGGAAGAGATATATGCTAAT
TGAAGCCTATTGAGAACTGAAACAAAGGGACGATTTGGCCTTTCCTCTCTGTATAAAAGA
CGTTTGAAAATCTTGTTCAGGGCTCGGGATTCAAACAGAAAGCTCCCGAGTCCGGCCGGC
CGTCAATAAACCATTTTTTCCTTCTCAAAATCATTCCTGAGTCCTGGCCTCTCTATACTC
AATTAATTGAACTTCTCTTAAATTCCACAACAGTAGAAATAGAGCTTTTCCATTGTGTGC
ATAGCAATCCCAGAGAAACAGAGACTCTGGCCCTGGTCTAGCCTGAGGCTTACCTCTATA
GGATTCATTATTCCGTAGAGAATATGCCAGACCTAAAACATAAATCTAAACCTATATTCA
GAGAGCTGGATCTCATCAGAAGAGAGAAGAGCAGCGTGGGTACAACTCAGTGGTTGAGCA
TGTGCATTGCATGTCTGAGGTCCCAAGTTCAATCCCTGGTACCTCCTAAAAGAAGAAAGG
AGAAAAAAATATGCTTAAAAAATCAAATCACTCTCTTTTCTGTGCCCTTTTAAGATTAAT
TCAGTGCTTTAATTGGTTAGCACAGAAGGGCAAAAGAAGTCTCCATAAAATCCAGGCAGT
AGGCTGTAAAATCCTCTTTCAATCCTATCTAGAATTGCAGCTGAACTAGGAAGAAAAAAA
AAAATCAGATCAAATGTCTACCTTGTGGCTCTTAGGATATTTGTTGGGATATGAAATCAG
ATTTGTTAGACGAAATGCTTTTTTTGTAATTCTCTATAATGCATATTATAAACATATCCA
CAGTCATTCTCTAAATAGATAGTACGGACATTTGCATTCTTAGAAAAAATCGCCTTCATT
AAATTCTACATTTCACTTCAATGTTAATATGATGAGTTAGATATACTTAGATAGATAATT
GGGGCTATGCAAATATGGAATTTTAAACCATCTTACTGAGAAAGAAAAGATTAATTTTCA
AGAATAGAATAATTCTGTATAAAGGGAGTAGAAAATTAAAGATGATAAAAATAGTTCTGA
CCAAAGATTTAATTCAATCTAACTAATACCTTCTTGGAACTTCTTTGTTAATTAAAGAAA
CCATGTCAAAACTGACCTAAGGAGTAATTATTAAAGAAACTTAAAAGAATACAAATGAAG
AGTCGAGTTCCTTTTTAAAACCAGAAGCCACAAAACTGAATCTCATCTCATTTTTGTCAA
TAGTGATTTTGAATAACTATAGAGGATTGTTATCAAAAAGGTGAATAAACAGGCTGAAAT
ACTGAATAATCAATGGCATCTTTTTTCTTAGATTTATAAATATGTTTTGGATATTGTCTG
TATGATCAGAGAATGACTAGATATGCTAACATATATTTAACTGATTATTCACAACCTGAA
AAAAATATAATCAATCTTTAAATCCTTGAAATAAAGTCACTCAATGAAAATTCATAAGTT
ATACACACTTTTGTGAGGCCAAGTCTGACTACCGAAAATATTCAGCCTTTTAAATTTAAC
ATGACTTATTTATACTGCTACTTAGTTTAACTTCCAATTCCTCATACACATGCCAAAGCT
TTCACATCTTACTGTCTAAACAAATGATAGTGAAAAATCCAGGTATTTTTTAGAGTGTCT
ATGGAAGCATATATCACAACCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved