Dasypus_novemcinctus Locus Mono:399:SNORA36
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:399:SNORA36
Dasypus_novemcinctus
Mono:399:SNORA36
GeneScaffold_256
SNORA36
1001..1138
2138
GAATCTCTGGCCTGCCCATGTCCCAGCTGGACCCTGAGCCTCAGCGGAGTTGCAAAACC
TACTCTCCAGTTTGTTGGACTTACTCAGGTTAGCTAACAAGGAGGTGAGGAATAGTCAAC
CACCAAACCAAGGAACTGAGAGAGTCTACAACTGCAAGCAGGAGAATCCCATCCATCGCC
ATGCGGGATGAAAGCACCCTCTCAATTAAGAGGTGGAGGGGGCATCACCATCCCAGAGTC
CTCAGGATTGGGAAATAAAATATGGACTAGAATGGACTCACTGCTATTCCACTGTAGAAT
TATTGTGACTCTAGCAATGGAAGAAATTATATCACTGATGTGGAGAGACTGGCTACTGGA
GTTGCTGAAGGCAGGGAGAGGGAAAAAGAGGTGCAATATGGGGGAATTTTTGGAACTTGA
AATTGTCCTGAATGATGTTGCAGGGACAGATGCAGGACAATATATATCCTATCATAAACC
ACTGAATGGATTGGGAGAGAGTGTAAACTACAGTGTAAACTATAATCCAGGCTGTGTAAT
AGTGCTCCAAAATGTATTCATCAAATGCAATGAATGTACCACACTAATGAAAGAAGTTGT
TGATGTGGGAAAAGGGGGGATGGTGAGGGGAGTGGGGCATATGGGAATCTCCTATATTTT
TTTAAGGTAACATTTTATATGATCTATGTATCTTTTAAAAATAAATAAAAAATACGTTTA
AAAAAAAATGGTGCTGAGAGAACAGAATATCTACAATTGAAAGAATGAAACAGGACTCCC
ATCTCACTTCCTAGATAAAAATAACTCAAAATGCATCAAAGACCTAAACATAAAAGACAG
AACCATAAAATCCTAGAAGATAAAGTAGGAAAGCCTCCTCAAGATTTGGTGGTAGGAGGT
GAGTTCTTAAGACCCTACACCAAAAGCACGAGCAACAAAAGAAAAAACAGAGATATTGGA
CCTTCTCAAAATTAAATATTTTAACACTTCAAATGACTTTGTCACAAAGGTAAAAAGGCA
ACCTAATTTAGAGTAGCTTCCCTGTTCTGTTAATAAAACTTTGGAAAATTGAAACAGGAT
AGGATAAGTGGTTGGATAGAAAAGTACTGTTCTATTCACTTATGTCCCAGTCTACAAAAT
CAGGGAAGAGAAAAAAAAAAAGGAATATATTCAATTGGAGAAAATATTTGGAAACCACAT
ATCTGATTAGGGTTTGATTTCCATATTATATAAAGAGATCCTACAACTGAATGATAAAAA
GACAAGCAACCCAATTAATAAATGGACAAAAAACTTGAATAGGCATTTTTCCAAAGAGGA
AACACAAATGGAAAAAACAACAACAACAACAAAAAAAAACAGCTCAACATCACTAGCTAT
TAGAGATACACAAACCAAAACTACAATGAGATATCATTTCATACCCACTAGAATGGATAC
AAAAACATTTTTAAAAAAAAGAAAATTACAAGTGTTGGAGAGGTTATGGAGGAATAGGAA
CACCTATTCACTGGTGGTGGGAATGTAGAATGGTACAGCCACTGTGGAAGACTGTTTGGT
GGTTCCTAAGGAATTAAAATATAGATCAGCCATGTGATCCAGCAATACCACTAGTAGGTA
TATACCCAGAAGAACTGAGAGCAGCGACATGAACAGACATCTGCACACCAATTCATAGTG
GCATTATTCACAATTGCCAAAAGACTGAAAGAACCCAGGTGCCCATCAACCAGTGAATGG
AAAAACAAATTGTGATATATACATATGATGGAATATTATTCAGTTAATAAGAAGTAAAGT
CATGAAGTACATTACAACATGGATGAAACTTGAGAACATTATATTGAGTAAAGCAAGCCA
GACACAAAAGGACAAATATTGTATGATTTCACTATTACAAACTAAAAATAATGAGTAAAC
TCGTGGAGTTAATAGTCAGTCTAAAAGAAACAAGACGCAGCAAATAGATACAGAGAACAG
ACAACCGGGGCGGGGGGGGGGGGGGGTTTTAATAAATAAAATAAAATAAAATAAAATAAA
ATAGTCTATAGGTCATTGGAAGATAGAGTGAGAATAACAAATGGAAAGTTGAGGCTTAAT
CTGTGCAGAATTGGTAAAAATGGTTGTTTACAAATGCTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved