Dasypus_novemcinctus Locus Mono:44:SNORA70
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:44:SNORA70
Dasypus_novemcinctus
Mono:44:SNORA70
scaffold_15172
SNORA70
1001..1137
2137
TTCTATGTTTTCATATTTGCAGGATATATAAATGTAATTTTTTCCCTCATGCTATGTGT
CCCTAGAAATCAAATACCAATGCATGTTTCTTCTTCAAAATTGATAATGAATGAAAAGCA
ATTTCTTAACTCAACAAGAAGTGCTATATAATCCACAAAATCACACAAATGTGAGAGCAA
CGCAATAGTGATCCTGACATTGGCAGATGGCTTCTAAAAACATATATTTTACACCTCTGT
CAGCAGAACCTAACTACAGTTTGGAAAATGCATCAGAGTTTTAGGAAAGAAACACTATAG
ATTGACCATGAAAATGTGGTGTCAAGATCAGAGCCAGCAATGTAAGCATTGCTTAGGATA
TAGTTTGAAATGCTGACTCTCCAGCCACACCCCAGACCTACTGTATCAGAAATTCTGTGA
GAAGGTCTTAGTGTTTCAAAAAGCCTGGCAGGTAATGCTCAAGTTGAGAACTACCTGGAA
AAACATCTCAGCAATATATTTGAAGGATATGGACAGAGCAAACTCATTATCCTATAATCT
AATTTTACCATTTTCTGTTTTACATAGATCAGCAAAAGATCCTATATATTCTTCATGAAT
AACGTGTCTGTGCCCATTGTTTCCCTAGAAGAATTTATGCCCTGTGACTTTAGTTTATCA
GGAGGAATGTGGACCATGTGCTTGGTATATTAAAGGAACTCAATAAATATTTGTTGGCTT
AGTTGAACATAATTTCATAGAAGACATGATGGAATTATTTAGAAATGCTTTAAGAGAAAA
ATAAATATTCCAGGGAAAAGGGGGACTGCAAAAAGGGTTGCATTGTTTTAAAGCTGGGAA
TATCCATATGGTTTAACAACTTTTTAAAGAGGGAGAAGTCTTAGCTCAGAGAGGGTCATG
TGAATTTTCCAAGGTCAGACCAATTTTTGCTGTCAAAGTAAGGACAGAATTTAATTTCCT
AACTATAGTCTGGGAGCTTCTTTAAAATACACACCTTCTCTCTGCAGCCGATTAAGCCGA
CCTGCCCCCTCTTCCCATGGGGGCCCGGTGTGAAGTGGCTGCAGACAGCAACCTCCTTTG
GTAGTGTATGTGGCCTGTTGTCTGTACAGGTTGCCTTAAGGGACCTTGGGAGAAAGCCCC
TTCCTTACCTTTTTGCTGGGTCCTGTCTTGTGATCTCATGCCATCCGCAATCTATGCCTC
AGAAAGGTATGCGAAGTTGTCTTTGGAAAGCCCTCAGGGGACGGTGGCTCTGGGCCCAAT
CAGCCAGGGTCATCATGTTCCTCCCACACAAAGCCTGCAAAACAAGGAGCATGGTGATTT
GAGGGGCTGCCACGGGGGCAAATTTATATTTCCCCTGGGCCCCCACAAAAAAATCNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGATGACTTGATTTGGACACTTTCA
TATACTGAGAACTGCATTCTTTTAACCTAATAAATTCCTATGGTAAAAGCCAACCCATTT
CGGGTATATTGTTCTTAGCAGCTTTTAGCAAACTAAAAGTTATTGAAAAGATGAACTATA
TGTATTAACAAGACTGATCAGGGAATAACCAGAGAGAGAGAGCAAACTCGCAACCTCAAA
AATAAAAAGATACACATAGCTTAAGATAACATACATTTTTAGAAATAAGAGGATATTGAA
AACATCTTTACGCCAATTAATGTGAAACTTTAGATGGAATCAACAAATTCCTTAAAAATC
AATGATACCAAAGTATGAAAAGAAAGAGAAAATTTGAACACTATTATGTCTATTTTTTTG
TTTATTCTAATGACAAACTTTTCCACAAAAAAATCTTTAGACCCAAAGGAATTTACCTGA
ATTCTATTGATAGACATAATACAAATCTTATAAAACTCTTATGCATTCATTTTAAGAGGC
TAGCACAACCTTTATGCCAGAATCTGAAAATAACACTACAAAAAGGAAAATTACAATAAA
ATCTTTATCATGATTACAGGTACAAAGCCCTAGACAAAACTTAACAAAATACAAGTGGGG
CTTGTGTGTGTGTGTGTGTGTGTGCATACACATGTGCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved