Dasypus_novemcinctus Locus Mono:174:SNORA76
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:174:SNORA76
Dasypus_novemcinctus
Mono:174:SNORA76
scaffold_73895
SNORA76
1001..1130
2130
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACATTTAGGCTGTGGCTATTTCT
TTTAGGTATTTCCCTTCATTACAATAAAGGGTTCCATCCACTATTGAAATGAATTTTTCT
CTTCCTTTATATCTTTTAAAATTTTTAATTAATTAATCAGTTATTTAAATTAGAGAAGTT
GTAGTGAAATTTCCAGGTCATATGATAATTCTATACTTAACTTTCTGAGGAACTGCTAAA
CTGTCTTCTACAGTTGTGGTACCATTTTACACTCCCAACAAAAAATAATGTATGTTCCTA
TTTCTCCACATCCTCACCAACACTGGTAACTTTCTTTTTAAAAATAGTAGCCATTCCAGT
GGATGTGAAATGGTATCTTATTGTGGTTGCTTATCTTTTCATGTGTTTTTTAGCGATTTG
TATCTTCTCTTTGGGAAAATGTCTATTTAAGTCTTTGCCCATTTTTAATTGGATTGTTTG
CCTTTTTAGTGCTGAACTGTAGGATTTCTTTGTATGCTCTGGTTATTAAACCTCAATGGA
TATGTGGTTTTCAAATATTTTCTCCCCCTGAGTAGATTGTCTTCATTTTCATGATAAAGT
TCTTTAATGCAAAAAGTTTTTTTAAGAATTTTGATGAGGTCCCATTTATCTATTTTTTTC
TTTCGTTACTTGTGCTTTTGGTGTAAAGTCTAGGAAACCATTGCCTACCACAAGATCCTC
AAGATGCATCCCCACACTTTTTTCCAGGAGTTTTATAGTCCCAGTTTTTATATTTAGGTC
TTTGATCCATTTTGAATTAATTTTTGTATGTGGTGTGAGATAGGGGTCTTCTTTCATTCT
TTTGCATATGGATAACCAGTTCTCCTAGCACAATCTGTTGAAGAGACTATTCTTTCCCAT
TTAAGTGGACTTGGCACCCTTGTCAAAAATCAGTTGGTGATGCACTGCCTTTGAGACCCT
GCCATGCCTGCGCATGGCACTGGGGGTTAAGCTGCAGTGCCAGAGTATGTGCTTGCGCAA
ACTGGGGCCACCTGACCCTATGGGTGGTGACTTTAACTGTGAGTGATAGGACAAAAAAAA
GTCAATTGGTCATAGATGTAAGAGTCTATTTCTGAACTCTCAATTCTATTCCAGTCATTA
AAGTCAGAAAGTATGAGTCTTCAAACTTCATTTTTCTTTTTTGAGATGTTTTTGACTATT
TGAGGCCCCTTCTCCTTCCAAATAAATTTGATAATTGGCTTTTCCATTTCTGCAAAGTAG
GCTGCTGGAATTCTGACTGGGATTGTGTTGAATCTTTAAATCATTTTGGGTTGAATTGAC
ATGATTATTATATTTAGTGTTCTTATCTATTAATGTGAAATATCCTTCCATTTATTTAGG
TCTTCTTTGATTTACTTTAACAAGGTCTTATAGTTCTCTTTGTACAAGTCCTTTGCATCC
TTGATTAAATTTATTCCTAGATATTTGATTCTTTTAGTTGCTATTGTAAATGTGATTTTT
TCTTTATTTCCTCCTCAGATTGCTCATTACTAATGAATAAAAACTCTACTAATTTTTGCA
TGTTGTACCCTGCCACTTTGCAGAATTCATTTATCAGCTCTAGTAGCTTTGTTGTAGTTT
ATTCTGTTCTTTTACCATTACGTATGATGTTCACTGTGGGTATTTCATATATGGCCTTTG
CATTTTGAGGAAGTTTTCTTCTATTTCTATTTTTCTAAGAGCTTTTATCAAGGAACGATG
CTGGGTTTTGTCAAATGCCTTTTTGGAATCAATTGAGATGATCATGTGTTTTTGCCCTTC
CTTTTATTAATGTGATATATTACACTAACCACCTTGCATACCTCGGAGGACAAAACCCAC
TTGATCATGGGGTAGAATTCTTTTAATGTGCTGTTGGATTTGATTTGCAAGTTTTTCTTG
AGGATGTTTGTATCTATACTCATAAGAGAAATTGGTCTGTAATTTTCTTTTCTTATAGTA
TCTTTATCTGGCTTAGGTATTAGGGTGATATTGGCCTGTTGGAATGAGTTAGGCAGTGTT
CTCTCCTGTCCAGTGTTTTGGAAGAGTTTGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved