Dasypus_novemcinctus Locus Mono:285:SNORA54
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:285:SNORA54
Dasypus_novemcinctus
Mono:285:SNORA54
scaffold_169745
SNORA54
1001..1128
1256
CCATTAAGTATATTTGAGCTAAGCCATCCCGTCTTTTTTTATCTGTGAGTGATTGGATG
GTCATCTTGGTGTCTTCCTGTTGTCTTACCTCAGCTGTTGTCCATGCTAGGCCCTCTGCT
CTGTGCTGGCAGCACTGTTCGTGACCCGCTAGCCTGTTTGCTGCTAACGGGTTCCATTCC
AGTGCAACATTATGCCCCAGAACCGACAACTGACTGACTGGCCGTGTGGCTCGCAGTTTT
GGGTCCTGGAGACACAGCCCTGTGGCTTGGCTTTGGGCGGGGGATCTTGTGAAGTGAGAG
GGACCCCAGACCTGGGGGTGATCTCTGCTTCCCAGCTCAGCACCAGCTCTCAGGTTGGTA
GAGGAATGGAGTGTCTTTATTCCAAATCCTGCAGCAGTGCCTGATGGGGTGGAGGGCTGC
GTCTGACCCTTGTACTATTCTCTCTGTATTCCAGTGTGGGAGGGGGCAAGGCTTGGTGTT
CCAGCTCCACCTGGGGTACAGCCACTGCCTCCTGCAGGCTTGTCTTGGGCTTCACCTGAG
GCCTTCAGTAGTGCTCGGGCTGGTTTGCTGAGCTGAGTCCTCACCCCACCCACCCCCAGT
CTTGTGTGGGTGTGTGCTGTTGGAAGAGTCTGGTGGGTTTTTCCCCCTCCCCCTCCTTTC
TCACCTATGACATTCAGACTCAGTTTACTAACTTTTCTCCCTCGGGCTCAAGTCCTCTTT
TTTTCCTTTGCTCTTTATTGGATACACATCTGCAGGTTTGTTTCCTGGGTTGGTTTGCTC
TCCTTTCAGCAGGCCTCCTCCTTTCGTCCTCCATCTCCCGTGATGTCCTACAAAGAACAG
AGCCTCCTTTGTGGGTAGAGCATACACAGAGAAGCTTTTGCTGTCCTTGCTTCCCCCAAT
ATAAAAGATATATATGTTTGTTATTGGAAGTTGGGTGATGAAAGAAGGTACAGAGAACAT
GGTTAGAATCTCCATCTTCTCAAAATAACTTCTAACAGCTTAGTGTATTTTCCTGAAATC
CTCTTTTGTTTTTGAAAATATTTTGAAATATTTAAGGCATTAAAGTTACAAAGAAAACAG
AATTGATTAGTCTTAGCCATGAAAGGGCTGTCTGTCTGCAGCTGCTGTCTGGGTCTCATC
ACTCCTCTTGTTCCCTCCGAAGGCTACTACAGCCTTGGACTTGGCTGTCTCTTTTCTACG
TGTGTGTATCTTAGGGAATTGGAAGTACAGCGTTTGTGCAGTCTACACAACTTTGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved