Dasypus_novemcinctus Locus Mono:386:SNORD83
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:386:SNORD83
Dasypus_novemcinctus
Mono:386:SNORD83
GeneScaffold_7456
SNORD83
1001..1078
2078
TTTTTTTCACTGGTAGTCACGGAGGAATTAGAAGAGGTTTCTGAAAAAAAAAAAAAAAA
ATTTTTAGACAGGCATTTTCCAAGGGCAGCCTCCGAGCGCGCGGCACTATAGAACCGCGG
AAGGCCCGTTTTCCGGCGCCGTGCGCCTGCGCGCTGACAGCCAAGAAGGCGGGAGGACGG
CTAGAGGGAAGCGGAGACCGGAAGTGAAGGCAGAGTCCCTACTTCGTCGCTGTTGCTGCC
GCCATACGCGCCCGCCCTGCTCAGGTAAGCTTCGGCCTTCGGTACCATCCGCTTCCATCC
TTACTTCTCCGTGGCCATCCGGTCGCATGGGTCTCCGATATCCGCCCCAGAGGCGACAAT
GTTGTCGCTGGGACCTAATTGGGTCGTTATTTCCTTTTCTCCATCCCTTTCGAGAGCAAA
GATCTCTCCGGGAGGAGGCAGCAGAAACCGGGGGCGGGGGTGCAATCCAAGATGGTGGCC
CCGGTGCTTTTGTGTTCCTTTTATCTTTGGCTCCTCCGTGGGTCTCGCTTACCCGAGGCC
CCGGCGACCAGAGAGGAGGCGCTAGGCCTCCCCTGGTTCCGAGCGTTTGCAGAGGGCGGG
GCCTTCTCAATTTCCCCGTCGCCTCGGGGCCTCTCTCGGCCCGCGGCGGGAACGGGGAGG
AGCCAGCTTCCGGACCCAGGTGGACTCTCCTCCTCTCGGCTTTGGCAGTTCTTGGAGGGT
TTTCCGAACGTTCGCGAGTGGTTTCATTGTGTAAGTGGTTTTCCGGAAGGAGTCTCCTTT
GCGGAGTGATAGAAACGGTGATGCGAGACCGTTTGGTAAAGGTTCTTTTAAAGTCGGAGC
GAAGGTACTTCCTCCTTAGTTACATAGGTATTAACTTCTCTCTCAACGTGTGATGGAGAG
ATGATTCTCCCGGCGTTAGTTTCACGTTTTTTTTTGTTTTTTTTTTAAGTAGCGAAAGGG
TGTTGAGTGAGGGGCTGTGGAGCTGTGGGAGGTGGATGGCAGCCACGTGATGTTTTCGTT
TTGAAAAGTGAGCGCTTTGCGCGCTGATGACCTTAATCTATCACCCTTGACTGATGGCTG
CTGTGGTGGAGGTTGACACCTTGAGATTATAAGGATAGCACAAGGTCTTTCCTTGAAGAC
TTTTTAGAAATTATTTTTCATCTCTGTTTTCCACACTCCCACCCCCCCTTCTCCCATTAG
TTAACATTGTTTTCCATTATCCGATTTTCCTCACTCTTGTTACTTAACGTATCTAGAATT
TATAACTGGTCTTCCTCTTCCAACTTCCTGGTTTCCTCAATTCCCATCCTAGTCTTGTTG
GGAACCTGTGCCTGGGGCGGTTACTTACATTTTCTCTATTGCTTTTCACTTTTATATTTT
GTATGTGTTGCCTTTTTTTTCCACGAAAAGGTGTCATAGTTTAGGAGAGAGAAGAGTGGG
AATGGAGGCTTAAAGTGGTGAAGTCTCTGCTCATGTCTGATAAGCTTTCCGTCTTTTTTC
CCCCTACCTCTTCTTTCAGAAACTAGTATCTTTCTTTTCCTCTCCTTTTCCCCAGACCCC
CTACCCTTTCTTCCTTGATTTCAGCTATTCTGCCTGAACCCATCTAGAGACCCCCTCCCT
TTCCCCTACTGCCGGCCCAGTTATGGCAGAAAACGATGTGGACAATGAGCTGTTGGACTA
TGAAGATGATGAGGTGGAGACAGCAGCTGGGGGAGATGGGGCTGAGGCCCCTGCCAAGAA
GGATGTCAAGGGCTCCTATGTCTCCATCCACAGCTCTGGCTTTCGTGACTTCTTGCTCAA
GCCAGAGTTGCTCCGGGCCATTGTTGACTGTGGCTTTGAGCATCCATCAGAAGGTAATTT
TTCCCGTGGGCATAGAATACTCTTTAGAGCTATAAGAAACAGATGTGGGTCACGGTTCCT
CAGGTGATAAGATTTATATTTGGGACAGACCAAAAAGTAAAGAAGTAAGTAAAAATGATT
TTTAGCAATGGAGGAGATTTACATAGGCTGGTGTATCATTCTTGGTATCACAAAACTGTT
AGTGACCCAAAAGCAGCTTAGAGACCTGCTGTTTGTTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved