Dasypus_novemcinctus Locus Mono:137:SNORA71
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:137:SNORA71
Dasypus_novemcinctus
Mono:137:SNORA71
scaffold_52686
SNORA71
1001..1133
1332
TAGGTTATGGCAGAATATTTAATGGCCTGTATCTGCCGTTGCAATGTCATTCAGGACAA
TTCCAAGTCCTGAAAATCTGGCAGGGAGGTTCGAGGGGTCTCTGCAGGACAAGACAACAC
TTGCTGGCAGCTCTCTCCAATTCTGGCCATCGACATCAGCATTGGCATTGGCCTCCCTCC
CTGGCTCTGCTCATCTCTGGCACTGCGTTTCAGGGCAATCGCTGCTGCTTGTGTCCTGGT
CACTGAGAGTGCAGTGAGAAGAATTGCAGAAAGCATTTCCCCAGGTTTGGAGGGCCCATC
CCCATCCCCTGGGAAGACAGGCGCTTTAACACACTCTGGCTTCTCTTGCCAATGCTTTCT
GCCTCTGGGGCTTTGTGAGCTGCTGTTTCCTCATTTGACCTTTCTCAGCTTGACCTCTTG
GTAGAAACTTGGCTATGTGTATCGAGGACTATTTGTTCCCCAGGACAGGTTAACTAGTGT
GAGGGTGGCTGAGGATCAAAGAATCCTGCAGAGAGGAAGGAGGCAACATTCCATTTCACT
AGCCAGATGAATTCTAATAACTGAATGCATGAATAAGTTTGACGTTAAGTGCATACAGTG
GTTGCCATAGGATTTCTAAAGAAAGATGACCATTTGGAGGTAGTGTGCCTGGATAAGGTT
TTTGAAGGACTCAAATAGGAAGGGACATTGGGAAGGTGATCAGGAAAAATGATGAAAAAG
CAAATTTTGGTTTTTGGGGAAGAGGGGCTCAACTAATTCTGAAAAAAAAAAATTCCTCAT
GTCCCAGTCTGCTCTTGCCTCTGAGGGATTAAAAAGTAAAAAAAGAATAAACCAAACTGA
TCCAAATAAAGTGATATTAATAAAATAACAAAAGCATAAATCAAATGGCAGAAAATGAAT
GTAGCTTACTTGAGAGCAATAGCCAAATGATTTTAGGAATGAGAAAAAAGACCCAGTACA
AAGTAGAGAATAAAAAACTAGTTGGAGAATAACATGTTGGAATTTTTACCCCAAACTTTA
AAACTTCAGTAAAATGAATACATTCCAAGAAAATATTTAACAAAACTTATTTAAGGAAAA
AAGACAGCTTGAATAATCTGATAAGAAAATTTGAATCAGTGATTAATCTTTCCACAAGTA
AAACACCATATCCAGGCAGTTTTATAGGTGAATTCTACAAAGTCTTTAAAGCATAGCCTT
AAAAAAAAAAACCCATAGTACTGTAAAATACAAACTTGAATTCAATTGTAAATGATGGAC
TATAGCTAAATAGTACAATTATAAAAATGTCCTTTCATGAACTATAACAAATTACNNNNN
NNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved