Dasypus_novemcinctus Locus Mono:295:SNORA65
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:295:SNORA65
Dasypus_novemcinctus
Mono:295:SNORA65
scaffold_187102
SNORA65
1001..1130
1564
ATAAAACTCATTTATTCCCATATATCTAATAGCTGATTTTTAAAATACTTTAATATATA
TGATATGATCTAATATTTTACGATATATGTATATTCAAGTGATTGCTTTCCTAATAAGTA
TATGACTTTAGCCCAGAGTTTATCTTAACATGTCTACTGAATAGTCTATAACGTTCCCTG
GGTTTTAACCATCTCAGGAGGGAAAAATTCAGTTTGTAAAAAGGCTTTCTCACAAATCTA
TCACTTTTAGTTTGTGTTTGGAAATTTAGAATTCACAAAGTAACGCAAAGAAAATTAGAA
AATATCACATTTTAAGGAACTCAATCTGTATCATATTCTACCTCTGTACGATGAATACAT
ATCAAGTAATCCATGCTACTTGATTTAATTAGCTTTCTAAATTTCTAAAATTTAAATTTA
AACACTTCATAACCACCTGCCACTGCACCTGACCAGTTCTTTGTTGGCTGGTGAAATCCA
GTGGTGAGATGATACTAAGCCCCAGCTTAGGAAACAGGCTTGTTCTTCATGCAGATGATT
CTGTGCTGAAAGCATGACAACAGCCTGGAAATGAACACAGGAGGACATAATGTATTTTGC
TGTGGTTGTGGCAAACTTTTGATGTATTTAGTATTTTTCTTTTCTACAGTTATACTCAGT
GGAAATATCACCTTTGATGAGATTTACAACATTGCGCACATATGCAGCACAATATTTAGC
CTGAGAACTTCTGGAACCATTAAAGAGATTCCGGGGACTGCCCAGTCTGTGGGCTGCATT
GTTAGTGGCCACCACCCTCATGACATCACAGATGACCCCAACAGTGGTGCAGAGGAATGT
CCAGCTAGTTAAGAACTACCAAGGAAAATAGTTCAATAAAAGATCGTTTGACACCCGGTA
AATAAACATATAGACACTTTATTGAAGGAAAAAACATGGTTACATTAAAAACTTCTAAAA
TGATTTCTCTAAATTTTTTATTATCTCAACATTCACTACTTCAAAAAGAAAGTTTATAAA
TGGCTTATTTTACAATCCATTGTCATCCAAATAGAGACTAAGTTAATGAACACCAAAGAA
AGCATTTATCATGTGGTGTAGTAGTAGAAAAATATAGTTATTTGTGCAGTAAGTTTATGG
ATAGTAAACATATGAAAAGATAATAATTTAAAAGCTTGCTTTGGTTATGTTTAGATATCA
TTTCTTTCCAAGATGATATATAAATTCAATGTAATTTCAAAGAAAATTCCAGGAAACCAT
TTGTAGATATCAACAAAGTGATTCTCAAATGTATATGAGTAAACAAAAGACAGAGATTTG
TAACCACAATACTATAGAAAAAGAATAAATTCAAATGATTGATACTTCCCAACTTCAAGA
CTTAGTATATAATAACCATAATCAATACAGCATTCATTGGTGAAAGAATATAGACATAAG
TCAGTGGAACAGAATAGAAAGCCACACATTATAGACCCACACAAATATAGTCAGTTGATC
TTTGACAAAGTTGCAAAGGCAATTCAATACAAAAAAACCTCTTTTCAACAAATGGTGCTG
CAACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved