Dasypus_novemcinctus Locus Mono:288:SNORA57
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:288:SNORA57
Dasypus_novemcinctus
Mono:288:SNORA57
scaffold_175326
SNORA57
1001..1142
1675
GTGGTGACACTTTGGGAATAAGAGCCCTGATAAGAGATTATATTCAGTGATCCTGGCAT
AGATGCTGTGGTAGTTGTGAAAGTCAGGGATTCTCAGACACATCTTAGACACACCCTCAC
AGAAGCCATCTTTCTTAGGGTACCACACTGTGGATAAAGATGTTGTTCTTCAAAGAAAAT
TCTGCAATGGCCAGCCCTCAAAGCTTCATCATCACATCATAGTAACACTGGGGTCTGCCA
GGGACCTCTGTCTTCTTCAAGTCAACATGGAATGGGAGAATTCTCCAGCCTCTGGGAAGT
AACATTGATCCATTCAGAAGAGCAAAGGGAGGGTCCACATCAAAAGCATGTTTCCTCTTA
GAAAAAGGAGAGGGAAGGAGATGTGGCTCAAGCAACTGAGCTCCCATCTACCACACGGGA
GGCCACAGGTTCAGTTCTGGTGCTTCCTGGAGAAGATGACCAAGACACGAACTAGCACAA
CAGGCAGGCATGGCGAGTTGATGCAACAAGATGATGCAACAAAGAGACACAACAAACCAG
GGAGTTGAGGTGGCTCAAGCCAAGTAATTTAGCACCTCTCTCCCAGATGGGAGGTCCCAG
GTTCAGTTCCCAGTGCCTCCTAAAGAGAAGATGAGCAAACACAGAGAGCATACAACAAAT
GGATACAGAGAGCAGACAGTGATTGCAAACAATGAGAGGGGGGAATAAATAAATAAAATA
AATCCTTAAAAAATTTTTAAAAAGAGAAAGGTAGCAAAGAGGAAAAATCTCTCCTCCCCC
AGAACATACTCAAAAGCCCACACACATACGACTGTAAATTCTCACCTCTTGTCTACATTT
ATCCCAGAAAATCATTCTAGTCTATCTCCTTCTAACATCCATCTTCCTTCCTTTCTCTCC
AAGTCCTCCCACTTTCATTTCCTCTCATTCCACTGGCTTGGCCAAGCATATTCATAATTA
TCTTCCTTAGCTCTAGATTTATTAAAGAAATTGGGGTAGACCCTCCTTTTCTTTGTGGGG
ACCAGGCATGCAATCCCAGTCCCCATTATGTATGGAGGCAGAGGAAGAGGACTCCAGCCC
CCTTGGCATCGTGTGCCAGCAGCTTCCCATCCACTGGTCCTATCCTCGATCACCGGGACA
TGGCTCCAAGAGCAGGGCAGAACCTATGAGGTCTGGCCAGCTCCACCCCGGGGTGCTTAT
GGCTTTTCCTTTGATTTCAGGTTTCTTGACTATGCCCCAGGCAGGAATGGTTGTATCCCC
TCCTCTCTTTAATCCTGTTGTAATCAATAAAGGCCAATTTGTGTGTGTAAAAAAAAAATG
GGGTAGAAGGAACTATTACTTAAAGAGGTAGCAATCTCCCATCCCCTTATGATCTTATAT
AAGAGAAGAAAACTGAACTCCAAGTGATCTTTGATCCTTGCTAAATCAGGAACACTAACT
TAAATTTGTAGAGTGCTTTACAGTGATGCTTTTAAAACTTTAACTTGCATGTGACTATCT
GGGGATCTTGTTAAAATTCAGGTTCTGATTCAGTAGATCTGGGGTGGAATCTGAGATCCT
CATATCTAATAAGCTCCCAGGTAACACTGATGCTGTGGATCCACAGGTCACACATTAAAT
AGCAGAGCTTAATGGACTTTACAATTATCTCTCACATATATAAGATTGCCCTGATC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved