Dasypus_novemcinctus Locus Mono:342:SNORA71
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:342:SNORA71
Dasypus_novemcinctus
Mono:342:SNORA71
scaffold_270744
SNORA71
1001..1134
1391
TCCGAAAAAACAAACCTGTGATAGAGGTGACTTTTGTTGTACTTAGGACCACATTGTTC
TTCTCCAACCTTAATATTTTTCCAGTGCCCCAAGTGATTTTTCTTTGCCTCCCCCTGGCA
GGGAGATTTTGGGGTCTTTGCAGGAAAGAATGGCTGCTACTGGGGTCCTCTGTACAGCTG
AGTTCTTCATTAACCAACCTATTCCACAAGCCACTGGCAGCTGCTTCCTTTCCTGGATCT
CTCTCTGCCCTCGTATGCACCTGCAGTCAAAAGTGATCGTGGGCTGCCTGTGTCCTGGTC
ATGGATAATGCAGGGAGAGGAATTGTGGAAAGCAGTTTCCCGTGTTTGGAGGGTCCACAC
CTGTCCCTTTCAAATGCTGGCGCTTTCACACACTCTTGCTTTTCTCCTGCCAGCTCTTTG
CAGCCATGGGGGCATTGTGGGCTGCTGTGTGAGAGTGATAGATTTTGTAGCTTGCTCTTT
CTTAGCTTCTGTTATCAGAGACCAGGCTGTGTATATATCAGTATTTAGATACGTTGAGGG
CAATTGAGGATTATAGAGCATTAGTCCTACTTTTATGACCCACAATACCTTTTTTAAGGA
GCCAAGATGAATTACATATAGTGAGTAAGTATGATGTTCGGTGGTAGATGGTGATTATCA
TAAGAATTTCAGGGAGAAGCGGCTTTATAGCTGGTGGCTCTGGCCAGGCTTTGAAAGAGT
GAAATGCACTGGGCATTAGGAAGGTATTTCGGAAGTGGGAGCAGCAGGAGCAGAACTTTG
AGGCTGGAGTTAGTGTGAGCACCTGCTCAGGAGCTCACAGTCCCACCGGGGAGACATACA
CAGGCCAAGTAGTGACAATATGAAGGGTGAGAGCCCCTGAGAGCAAGCTCTTTGCCATTT
ATTCTGGGCCCTCAAAAGCACTGTTTGAAATAAAATAATTTTTGGAAAACCTGGACTCTT
AATAGATTTTTCATTTGACTTTTTCTCTGTGAGCACTGAGATTCCTTTTCAAGATGAGTT
TGGTGTGAATAAATTGGCAGCTCATGCTTGAGTAATTGGGCATTCTCCTTGATGTCAACT
CAAAGAGGGAGAAGATAATATTGGAGACCAAATACTTTAGTGACCTCCTGCTCTGTGGGC
CTCCTCCCCACTCTTGGGGAACAGCCATGGATCCAGAGGTTGTCACAGGCAGCCCTAAGG
TGATGAGGCACTTACGCCTTCAGGATGATGACCTGGGGTCCCAGCTCCCCTGGAGGGCCC
TCCTCGTGGTAAGTTAGTGCCAGGAGGCAATGCTGCTCTGTGTTTCTGCAGATGGAAATG
CCAAACCTCCGGCCTCATTTGACTTTCTCCTTTACATTATTTTGGGGCTGATCATGGACT
CTGGAGTACAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved