Dasypus_novemcinctus Locus Mono:6:SNORD115
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:6:SNORD115
Dasypus_novemcinctus
Mono:6:SNORD115
scaffold_5046
SNORD115
1001..1076
2076
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTTTTCAGGAAGGTGTCTCTGATAAGCATT
TGTTTGTGAAATGGAAAAAATGCCTGGAGGAGCCTTGGCTTGGGTCAATAATGAGAATTT
AACTAGTTGAAGTCAGATGACATAAAAATCATTCTCAGTAGGATTACACTGAGGTAGAGT
CTTAGGTGACAGTCCAAAGACAGGAAATTCTGATTCTTTATTTGTATTTCAGTGCAATTT
AAATGGGATTGATACATTTAAACTGATGTGGGCTATGGGTGGAAGGCTCTTTGTCTCTTC
AGAGATAACCTAAACTGAAGGCTGTGGGTGTGGAACGGTAAGAGGCTGCAGTCCTGCCCT
TAGGGACAATGGCAACAGGCTCCAGTCCCAGGAAACAGTTTAACAATGCAAGGGCTATAA
ACTTTAAGTATTTAGGGGAAATGCAAAAACCAAATATGCTAAAAGCTTATCTAGAATATC
TGGAGTCCATGCTAAAAGCTTACCTAAGATGTGGAAGATATATATGCTAATTGAAGCCTA
TTGAGAACTGAAACAAAGGGACCATTTCGCTTTTCCTCTCTGTATAAAAGAGGTTTGAAA
ATCTTGTTCAGGGCTCGGGATTCAAACAGAAAGCTCCCAAGTCCGGCCAGCCGTCAATAA
ACCATTTTTCCTTTCTCAAAATCATTGCTGAGTCCTGGCCTCTCTATACTCAAATAATTG
AGCTTCTTTCTAATTCCACAACACTACCTCTAGGCTTTGGAAAGCAGGGCTGCTCTGGGG
GCTTGGTGGCCCCTCTTCTGCAGTTTTACATTATTGAACCAACAGTTTCTGGATTTCTTT
ATTATAAAGTCCATATTATTGGGAGAGGGAATTTGATTGGCTCAACTGGACTCAGGTGTC
TGCCTCTGTTCAAACAATTTTAGACAATGGGGCAGTGACAGGAGAAACATAAATGCTCTG
AGAAGAGCCCTGTGGGGGAAGTGTGTGGTTCCCAATGACAAGGCAGTACAGACAACTTTC
CATGGAATAGCTGTGACTACTTTCTGGCCAGTCACCAATATGCTTTGTTTCTCTGCTTTG
ATGGAGCCATTCCACTGAAGCAGGGGCTTCTGGGTAGTCTCCCTTTTCTATCTCTAGTGA
AAATTGTTATGCTAGACATTTTGATAGCAAAAGCTGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved