Dasypus_novemcinctus Locus Mono:381:SNORD49
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:381:SNORD49
Dasypus_novemcinctus
Mono:381:SNORD49
GeneScaffold_6302
SNORD49
1001..1071
2071
GAGAGACCACAGACTCAACAGGAGGGGGGGAGTCCTTAGGTGGACGAGTCTACCCCTTC
AAGTGGGCCGGAAGTTCCCGTGAATCGTCGACAGGCCCCCCTCCCTTCTGTGAGAGTGAG
ACGTCCCGGCTCCTTAAATGCCTGGCGCACGGAGCGGACCGTCTTTCCGCAGTTGTCGTC
ATGGGGTAAGGGCTGTTCGCGTGTGGGCTTAGTGGCGGGCGGTAAAGGGAACTAAGGGAC
AAGCGCCTTTCTCATTTCTGGAGTGATGCTTCCGCAGAGGTTGACTCGCAGGGAGGAGGG
TGCGTCCCCCTGTGCCAGGGCGGGCGCTGGGCTCCCTGTCCGAGCGCGCGTGCTTGTCCC
GCAGGGCCAACGCGGGAGCCTGGGGTCCCCGAAGGCCGGGCCGCCCTTCCCCGGGCCCGC
CGTGGGTCGCGTGCAAACCCGAGAGAGTTGGGTGAGTTGGGGTCTGGCTGTGGTTTTCGG
TGACCGGGGACCCTTCGCGGGGGTGAGGTTTGGAATGGGGAGGCGTGGACTGTTGTGATG
ATACTGGTAATAGGAAGTGCCGTCAGAAGCGATAACTGACGATGTTTTATGCCCGTCTGA
CCGCAGTCGTTGAGCCTCCACCGTTTAGTTGCATTTAACTTCTAGAATCTGCTGTAAGTG
TATGCTCTTGTTTCTCCGGGTTCCAGGTCACAGACTCACTGCAGGCTATTGAAGACTGCA
GCATCCCATCATGAGGTGTAAGGTACGGTTTTTGTTAAGTTAAATAACACTGAAATTGAA
CAGTTGTAGATTTCAGCTTTTCTAAAACTTACATACCAAGTCCTTGCATAGTATGCTCCG
GCGCTAGCCTGGAACTGTATTTAAACAGTTTTAAGCAGAAACATACTGAAGCATGTCTCC
AGTGCCCATCTTTTAGACAAGTTTAGTTTAAAGTAATCCAGGGTGTCCCCAATGCCAGTT
GAGCCAGAGGAGTGGTACTGGGAAGAGGTGAGGTGCGTGGCTGCTCTGATGAAAACCATA
ATAGGAAGTGCCGTCAGAAGCGATAACTGACGATAACTATTCTTGGCTGACTGCAGTCAC
CAAGTCCTCCCCTGCTGGCTGGTGCCCAAAAATGTCAGTCTGAANNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATAGCTGGAATTAC
CGGCAGATGGTGTAGTGGTGAGCATGGTTTTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved