Dasypus_novemcinctus Locus Mono:346:SNORA13
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:346:SNORA13
Dasypus_novemcinctus
Mono:346:SNORA13
scaffold_280627
SNORA13
1001..1139
1144
AGGCAGGCCTTTGTGTTTTCCATCCGAGTTGGGGGGAAACTAGTGAATGTGGTGTCAAA
AAAAGGTCCCTTGAAAATTCTTTTGCAGCCTATTCCTGTCCTTGAATTTATTGTGTTTGG
TGTAAGAGCTGCATAGGTAACAGTTTGTTTTTATATTTTATTTGTTTACACATACAGTCC
TTGTTCTGCCAAACTCAGTATTGTATCTCTTACTTATGAAAAAAAAAGAGGTAAGCAGAT
GTTACTCAAGCAGTTTGGCACCTGCCTATCACATGGGAGTTCCTGGGTTCAGTTCTCGGT
GCCTCCTAAAGAAGACGAGCTAGACAGTAAGCTGATGCAACAGGCTGATGCAACAAGATG
ACAATGCAACAAGATGATGTCACAACAAGATGATGACACAACAAGGAAAAACAATGTGAG
ACACAACAAGCAGGGAGTGGAGGTGGCTCAAGGGATTCAGTGTCTCCTTCCCACATAGGA
GGTCCCAGATTCCTTCCTGGTGCCTCTTGAAAAGAGTGAAAGATGAATGGATACAGAGAG
CAGACAGCAAGTGCAAAAACAGCAAGGGGGGAGAGGAGAAATAAATTAAATAAATCTGTA
AAAAAAAACAATAGAAAAAATCACCAAGGTCAAATATTGATTGATGGAGAAGATCAATAA
AATTGATAACCTTTAGCTAGACTTAAAAAGAAATAGAGAGGTTGCAAGTAACTAAAATCA
GAAATGGAAGGGGAATATTACTACCAACCCGACAGAAATAAAAAGGCTTATAAGAAGATA
CTATGTGCAACAATATTCCAAGAAATTAAATAACCTAGTGAAATGGACAAGTTCCTAGAC
ATACATGAGCTACCTAAACTGATGCAAGAAGAAATGAAAGATCTCAGCAGACCTATAAAA
ATGTCCATTGATTTAATCAATAATTAAAACTTCCCAACAAAAAAAACCCTGTACCAGATG
GCTTCACTGGTGAATTTTATAGACATTTCATGAAAATTTAATGTGAATTTTACTTTAAGT
CTTCCAAATATTAAAGAGGAAGAAACATTTCCTAAGTCATTGTAAGAGGCCAACATCACC
CTCATGCCAAAGCCAGACACAAATACCACCAGAAAACAAATGACAAACCAATAACCCTTA
TGAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved