Dasypus_novemcinctus Locus Mono:241:SNORA73
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:241:SNORA73
Dasypus_novemcinctus
Mono:241:SNORA73
scaffold_124077
SNORA73
1001..1202
1345
GCTGCAACCAGTCTAGTGAAATTTTATATGGCCATAAAAAGTCTTATACCTTGCCTCCT
TTTAAATTATATGTGTGTGTATATATGCATGGGTGAGAAACGTTTTGTCCTTAGTCAAGA
AACATCCATTAAAAACATGAATCTCCAACGTGGATACCCCAGGAGGTCACTCTCCCCAGG
CTCTGTCCAGGTGGCACAGGGGAGAAAAGGGCTCTGCCCAATGATGTACAGTCCCATTCC
ACGACGCTGGAGAGGAAGGTGGGCCTCAGGCCCGCATCTGCATATTCCTACAGCTTCTCA
GTCCTATAGACAATGCCTGAAGAGACAAACCATGCAGGAAACATATCTCATATTAAAAAT
TAAAATTCAAAGACCTTAAAAAGGAATCTAAACCTGTTTTATATTTGTGTACATTCAAGA
GCGAAGAGGAGCGAAGCCTTGACATTGAAATACAAGGTGGGAAACTGGATGCTATACTAT
CTTGTAGATGATCATGGAGGGTTTGAAAATTGGCACACACATCTTCATGTTTGGCTTTTT
AACTGAGTAAATTAAAGAATTCCAGCCTTAAAAGCAGAATCATCGAAGTGGCTAGAAATG
CAAATAAATGTTCAGGTCACCCCAAAACCATACACCAGTTTTAATATCTAATGTACTAAA
TAACCCATGTATTCTGAGAATAAGAGCAAAGTAGAGTAGCCTATTAAACTAACATATTTA
TGAATACAAATAAAGATGATTTTGTAATTTAAAAAAAAAACAAAACATGAATCATTGTAG
CAGTATTAATAAGTGCCAGCTTCAGGGTCACAGATGCTTAAATGGCATTAATTTAAACCA
TTATGCCTTTCCAAGCTCTGTATTTTATGTTTTTAACTCCTAACCTTTCTTAGCATATCT
AAATTTAAAGGTTTTCTTTTCTTTCAAAATTTGCTGCTTAGTTGTACAGACCAAGGAAAA
ATATATAATTTAACTATGTTAGAAAGTCAAAAAGACTAAATAAACTGCTTTCAAGGTATG
TAACTGCTCCCTTCAAAGTGAAAGGCAACCTATATGACATCGGATTTAATGTGTCAAGAG
ATTCCCCCATCCTTTTCTTTGTTTCTTCACAGTTACCTGTGAAGCAAAGATCATCTGACC
AAATAAAGTACCAATGCACTGGTACAAGAATTTTTTTTATTCTAGATATATTTTATGGAA
GTTAAAACTTCTTATAACACAGAGACCCAAGGTAGTTTCTTTTAAAATTTATTGTTAAAC
AAGTAGTGCCTCAAGTTCCGCCCCGCTGTATTCTTCCTCACTAAGCAACTCTTCATATTC
TTCACTGAGTTCATCCACATCCCCAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved