Dasypus_novemcinctus Locus Mono:423:SNORA44
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:423:SNORA44
Dasypus_novemcinctus
Mono:423:SNORA44
GeneScaffold_7843
SNORA44
1001..1111
2111
ATAGTCTAAATGAACATGAAGTCATGATAAACATAGCCATCTATACAAACACAAACTAA
ATACATATGGAAACAAAATACCCTGGAATAGAATCCAGCAAACAAACAAACGAAAATATT
TATATCTTCAAAGAGTTAAGATACTAGAGTATCAGATACAGAAATAAATCATATGGAATG
AAATGAAAACAATATATTAATGACCAGGATGATTTGCGGAGAAATCTAGAAATGATACAT
AAAATTATTAAAATAAAATATCTGGTGGAAGAGTTAAATATTAGATTAGACACAGCTGAA
CAAAGAATTAGAAAATTGAAAGAAAGATCAGAAAAAATTATTCAAATAGAGCTTTGTGAA
AAAAATACATAAATGATTGTGAAGAGATAGAATAAGGGAATGACAAAGAGATAATGCTTA
AGATTATGTATAAAGTAATGACAATTAGCCTGGTGGCAGACAAATCATTAGCAATAATGC
AAGGGGGAAAAAGCAGGAGTTAGATCTTCAAAATAATGATAGAGGAAATATCCAATCACC
TTGAATTGTATACCAAACAAATCTCTTCAAGAAAATGGACAAAATAAAATTATTTTCAGG
TAATCTAAAATTTTGCTAACCACCCTTAGAACTTCATCAAAAGAACTCCTAAAGAATATA
TTTCAGGAAGAAGGAAAGTGGAGATCTAGGTTGTAAAAGTAATGGTGAGCAGGGAAATTG
GTAATGTGCAGGTAAATCTCTACAAACATTGGCTATCTGAAACAACAACAATAATAATGT
TAATATCCAACTTGTTAGGCTTTAAAAAAAGAGAGAACTAAAATACTGGAATAGAAGAGT
ATACAAGATTAGTGTTTGGGTTGGTAGGTCCTTCATTTATCTGATAGGAGAACAAAGATA
TTAATTAATCTAAGACTTTAGTAAGTATGCATGTTAAAATTTCAAGAATGACATTAAAAG
ATAAAAATTAATATTTAATTTCCAAAACGATATAGATTTAAAACAATAGATTAAGGGGTG
AATTTCCAACTGCATGTGAGAGCAACCTGGAGAGACTTTGACAGGCCAGGTCAGCAGAGT
ACCTGCAGCTGCCACTCAACTTTCCTATAATGTCTCAGGACCTGGGCTGGGAGGGACCCG
AGGCCAGGTGTTTCCATTTATTCTGCAGGTTACCCCTGAGTTTCCAAACAGTGTTAACAT
GTCTGAAGATGCCAGCTTGTTGCTGGAGCAGAGGTATCCTCCTTTTTTAGGTCTGTGATA
CCTAGAAAGCCATCCTCATCTGATTATGGACCTAGAGTTGGGAGAAGCACTCAGAAGAGG
CAGGCTAAAATGCACCTGGCTGGTTATTAGGTGGAAATTGTGAACTCTGCAAGGAGAGTC
CTTTGCTTTTTGTTGAGTGCTTCTATCCCTTGTGTCTGACATGTTGGTAACCAATAAAAT
AATTACTCTAAAAGAAAAAGAAAAAGAAGCTAGGCAAAATGAAACATGGAGAGAAAGAAA
ACAATGAGCAGAACAACAGTGAGCTGTGGAACAATTTCAAACAAAATATATTGTGTAACT
GGAGTCCCAGAGGAGGTAGGAAAACAGAAACATTATCTGAAGAAATAATGGCTATTTCTC
AAATTTGATATAAACTATAAAACCACAGTTCCAAGAACGTTGACAAAGCTCAAGTCGAAG
AAACATGAAGAAGATCATACCAAGGCATATCATAATTCAAATTGCTTCAACCAGGGAAGG
GGATTTGGCTCATTTGATAGAGCATCCGCCTACCAAATGGGAGGTCCAAGTTTCAAACCT
AGGGCCTTCTGACTTCTGTGCTGAAACTGGCCCACAATTTATTGCCCTGCCATTATATGT
TTTTTCTCTTGTCTATTTGTATTCCTCATGTTCAAATGAGTGCATCCCCTTAAGGGAGAT
CCTGCCCTGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCAGACCT
AAAGTTTCAGAATCTGCATTTAAATAGTATTCCCTGTTTGATTCATAAGTGGATTTAATG
GCTGAGAAGCAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved