Dasypus_novemcinctus Locus Mono:270:SNORA61
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:270:SNORA61
Dasypus_novemcinctus
Mono:270:SNORA61
scaffold_149954
SNORA61
1001..1108
2108
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCATTCCTTGATCATTTCAGGTTGCTA
TTGAGACCACTGGTCAATTTTTCTTTCTCGTTTTTTTTTTAGTACTGGGCCCAGGGATAA
ATCTAGATCTTGTGAGTGAGGAAGCCTGTGCTTAATCACTAAGCCACAATGGCTCCCGTG
AGTTGTTTTATTTGTTTGTTTGCTTTTGTTTTTAGGAGCCACTGGGAACAGAATGTGGGA
CCTCCCATGTGGGAAGCATGTGCTCAACTGCTTGATTCATAACTGCTCCACGACCTGGTC
AATTTTTTTATGTAGGTGTTTGTATTTTTCACACACAAAACACCCTCTGGTTCCCTTTCT
CATTGGATCTGAACACTGGTCTGGTTGGTTGTAAAAGGAGGAAAAGGAACTCTGAGGCTG
ACCTCACGGTTGTTTAGCTTCAAACTCGTTCAAACAAGGTTGAATTCTCTTTAAACCCCT
CCTTCCCTCTATAATGAGCATAATCTTAGGCTTTTTGGAGGGATGAGTAAATAAGTAGAT
TTGAAGTTCTGGACTGCTGGAAAAGAACTATTCAAATGAATTCTTCTTTATTAAAGGTAT
CCTCTTCTTTTAGGTCTATGATACCTAGAAAGCCATCTCATCTGATTATGGACCTAGAGT
TGGGAGGAGCACTGGGAAGAGGCAGGCTAAAAGACTCCTGGCTGATTATTAAGTGGAAAT
TGTGAACCTGGCAAGCAGAGTCCTTTGCTTTTTGTTCAGTGCTTATATCTCTTGTGTCTG
ACATGTTGGTGACCAATAAAATTTGCCTTACTCTTTGGAAAAAAATATTTTTCCCTTTGG
TTCTATCCAATATCTTTTGTTTCTCTGTTGAGACTCTGTATCTTTCCATTCATTTCAAGA
ATGTTCACCCTTAGTATGTTAGAGCATGGTTATGCATATTGCAGACATCTTGGTCATTTC
ACTTTATACCCAAGTTTATGGGTCTTTTGTAGTTAGAAGTTTTACATTTTGATATAGTCA
AATCTATTTTTGCCCTTTTACTCTTTGTGCTTTTTGTTGATCTTGTTTTAGGCATGCTAT
ATATAATATTTTATTTCATTTAATGTTGATGAGATAGAAAACCTATGAGGTAGATTTTAT
TCTTTCTTTAAGAAGTGAAGAAACTGAGGCTCAAGGAAGAAACATGTCTAGGGTTGCACA
GTGAGAGAAAGAGTTAAGATTGAATTTAGTCTTGCCTCCAAAGCTGGTTTACCATTGAGA
GTTGAGATTGAGTAGTTACTGTGAGAATGGAAATAGAACAGCAGATGTGTGAGCTATCAT
GTGGGCAGATGTACTGGATTTAGTAAAACATCAGCACTCTCTTCACAGTTCCGATAGTTT
TAAAAAACGATGCATTCATCTATTATTTTTTAATTTAATTTAGTTTTATTAGGAAATATA
TATAGTATC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved